An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
Q: UAA is a stop codon. Why does the UAA sequence in the segment of mRNA…
A: Stop codons do not specify any amino acid. When ribosome faces any stop codon, it stalls. When the…
Q: Which of the following is NOT an event associated with translation termination? A stop codon…
A: Hi, Thanks For Your Question. Answer : Correct Option Is A terminal amino acid is added to the…
Q: During the termination of translation, what is the correct polypeptide sequence which will be…
A: DNA is the storehouse of genetic information. This information age expect by the formation of an…
Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…
A: The sequence of protein is usually notated as a string of letters, according to the order of the…
Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…
A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: Answer : glycine, proline, alanine, arginine, The possible codons can be CCG CGC GCC GGC GCG CGG
Q: Consider this list (below) of steps involved in translation. These steps are out of order.…
A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…
Q: Using the Genetic Code Table in Figure 1.3, what is the proper sequence of amino acids in the…
A: DNA ( Deoxyribonucleic acid ) is two stranded ladder like structure which act as genetic material in…
Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…
A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…
Q: Which of the following best describes a sequence of events that happens during the elongation phase…
A: The translation is a process by which protein is synthesized using mRNA as a template. This process…
Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…
A: BASIC INFORMATION GENETIC CODE These are the codes which helps in the formation of the protein…
Q: describe, using diagrams etc., how information stored in the DNA is translated into a peptide. Be…
A: Usually Central dogma of Molecular Biology is followed during the process of protein synthesis which…
Q: If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read…
A: Protein synthesis is described as the process that ultimately results in the formation of proteins.…
Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…
A: An open reading frame in molecular genetics describes the part of your reading frame that has the…
Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…
A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…
Q: For translation, identify two things that happen during each step - initiation, elongation and…
A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…
Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…
A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…
Q: LIOCTOTmats Provide the three-letter amino acid sequence expected from each of the following mRNA…
A: Question - 1- Provide the three-letter amino acid sequence expected from each of the following mRNA…
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…
Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: You have an mRNA transcript that is 201 nucleotides long, including the Start and Stop codons. How…
A: In most living organisms, DNA is the genetic material. DNA contains all the genetic instructions…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: In prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated,…
A: Methionine which is a central molecule in one-carbon metabolism is an essential amino acid needed…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: What will be the overall anti-codon sequence in tRNA for this mRNA?…
A: Proteins are synthesized from DNA in two step process. These two processes are transcription and…
Q: Which of the following statements regarding the genetic code is false? The genetic code is…
A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…
Q: A mRNA strand is 5’ to 3 across the translation initiation complex. The start codon is ____ And…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: The amino acids are coded by the group of three bases called base triplets and codons.
Q: Which translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome? A.…
A: The translation process is responsible for synthesizing the protein in the cytoplasm of the cell.…
Q: The mRNA formed from the repeating tetranucleotide UUACincorporates only three amino acids, but the…
A: Answer- According to the genetic code, all the 20 amino acids are coded by 64 set codons of…
Q: What is the order of the polypeptide chain shown in the images provided? Starting at the…
A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…
Q: The codon and anticodon are base-paired together during the process of translation. Which of the…
A: The central dogma of molecular biology involves the transfer of information from DNA to proteins…
Q: Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for…
A: Translation is the process during which codons in mRNA are identified by tRNA with specific…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: For the codon sequence : 5’ GGA – AUA – UGG – UUC – CUA – 3’…
A: The translation is the process in which proteins are synthesized from the RNA. The ribosome and tRNA…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…
Q: A small section of bacterial mRNA has the following nucleotide sequence: GAC CCG AUG AAC The tRNA…
A: Translation It is the synthesis of proteins from the codons present in the mRNA. Anticodons…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation is the process of formation of protein from mRNA As in the question above start codon is…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: In panel a (see picture), a tRNA is already bound to the initiator codon at the start of the mRNA…
A: The central dogma states that the genetic information will flow from DNA to RNA and then to protein,…
Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…
A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…
Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the…
A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…
Q: The following sequence is from the template strand of a bacterial gene, and it includes the…
A: According to the central dogma of the molecular theory, the information stored in DNA is first…
Q: Below is a picture of a ribosome. Name and give a function of all the “players” of translation found…
A: In molecular biology, when the ribosomes present in the cytoplasm or endoplasmic reticulum…
Q: Which of the following mRNA codons signals the start of translation in eukaryotic cells? 5’-UGA-3’…
A: There are 3 stop codons: UAG(Amber) UAA(ochre) UGA(umber) These codons signal the termination of…
Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…
A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…
An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted.
5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Indicate the amino acid sequence of the protein encoded by the following mRNA molecule. Use the genetic code table and assume that the very first “AUG” the ribosome encounters will serve as the start codon and specify methionine. 5’-AAUUCAUGCCCAAAUUUGGGGCACGAAGCUUCUUAGGCUAGUCCUAAAAAA-3’The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion Substitution
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GOn the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterGiven the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.Part of a sequence of DNA from a person without this genetic disease is: TAG TAA AAA CCA CCC AGG Part of a sequence of DNA from a person with a genetic disease is: TAG TAA CCA CCC AGG The possible codons for some amino acids are shown in the table. Amino acid Codons glycine GGU GGC GGA GGG isoleucine AUU AUC phenylalanine UUU UUC serine UCU UCC UCA UCG Which amino acid is missing from a person with this genetic disease? serine glycine O phenylalanine isoleucine
- Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that is coded for. 5'-GCCAUGUUUCCGAGUUAUCCCAAAGAUAAAAAAGAG 3'mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…c) A gene in a bacteria has the following DNA sequences (the promoter sequence is positioned to the left but is not shown): 5'-CAATCATGGAATGCCATGCTTCATATGAATAGTTGACAT-3' 3'-GTTAGTACCT TACGGTACGAAGTATACTTATCAACTGTA-5' i) By referring to the codon table below, write the corresponding mRNA transcript and polypeptide translated from this DNA strand. 2 Second letter с A UUUPhe UAU Tyr UAC. UGU UGCJ UCU) UCC UCA UUG Leu UCG Cys UUC UUA Ser UAA Stop UGA Stop A UAG Stop UGG Trp G CUU CÚC CCU ССС CAU CGU His САC Pro CC CỦA Leu ССА CAA Arg CGA CUG J CCG) CAG Gin CGG AUU ACU AAU Asn AGU Ser AUC le АСC АCА AAC AAA AGC. Thr JArg AUA AGA AUG Met ACG AAG Lys AGG. GAU Asp GUU) GCU GCC GCA GCG GGU" GGC GGA GGG GUC Val GUA GAC Ala Gly GAA Glu GAGJ GUG ii) If the nucleotide indicated by the highlighted bold letter undergoes a mutation that resulted in deletion of the C:G base pair, what will be the resulting amino acid sequence following transcription and translation? Third letter DUAG DUAG DUAG A. First…