Consider the translation of the following mRNA base sequence below during proteinsynthesis and identify the following:5' CAA CGA AAG 3'1. Codon/s associated with this base sequence2. tRNA anticodons that are compatible with this base sequence3. The amino acids specified by this base sequence

As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Answered: Consider the translation of the…

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

First base of RNA codon Provide the sequence of amino acids that would be translated from the following strand of RNA. Use the chart provided below: Second base of RNA codon U A UUU UCU UAU UGU Phenylalanine Tyrosine Cysteine UUC (Phe) UCC UAC (Tyr) UGC (Cys) C U Serine UUA UCA (Ser) UAA Stop UGA Stop Leucine UUG (Leu) UCG UAG Stop UGG Tryptophan (Trp) G CUU CCU CAU CGU Histidine CUC CCC CAC (His) CGC 0 Leucine Proline Arginine CUA (Leu) CCA (Pro) CAA CGA (Arg) Glutamine CUG CCG CAG (Gln) CGG AUU ACU AAU AGU Asparagine Serine AUC Isoleucine ACC AAC (Asn) AGC (Ser) A (lle) Threonine AUA ACA (Thr) AAA AGA Lysine Arginine AUG Met or start ACG AAG (Lys) AGG (Arg) GUU GCU GAU GGU Aspartic GUC GCC GAC acid (Asp) GGC G Valine Alanine Glycine GUA (Val) GCA (Ala) GAA GGA (Gly) Glutamic GUG GCG GAG acid (Glu) GGG AUGGGC CUAGGAUUUCCAACCUAG Edit View Insert Format Tools Table 12pt Paragraph BI U T² : Third base of RNA codon
identify start/end site, which amino acid will be on the tRNA that is the first to bind to the A site of ribosome, anticodon on the tRNA in the P site of the ribosome when release factor bings to A site, and what amino acid sequence of the protein that will be formed from mRNA? Here is the mRNA sequence:5'GUUUCCCGUAUACAUGCGUGCCGGGGGCCCGUUACCAGGCCUCAUUAUUGGAUAACGGAAAAAAAAAAAAA3'
41. The following 9 TRNAS have anticodon loop regions that base pair with the mRNA in the ribosome. Using your knowledge of tRNA-MRNA base pairing and the genetic code chart (+lecture slides), indicate the MRNA codon message being read by the ribosome as well as the1-letter amino acids that is generated. Anticodon Anticodon Anticodon Anticodon 4 Anticodon Anticodon 6. 2 5'-IAG-3' 5'-UAU-3' 5'-АAА-3' 5'-CUC-3' 5'-GAU-3' 5'-AGA-3' codon MRNA 5'-__-3' 5' 3' 5' 3' 5' 3' 5' 3' 5' 3' 1 letter amino acid Anticodon Anticodon Anticodon 8 7 5'-CCG-3' 5'-GUU-3' 5'-CGC-3' codon 5'-__-3' 5' 3' 5' _3' mRNA 1 letter amino acid
Label the following regions on this tRNA molecule, stating the function of each:
The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?
The first nucleotide in mRNA that will be synthesized from DNA below is: 3'- ACGTATAGCCGGACGTCACTCGCTA-5' 5'-TGCATATCGGCCTGCAGTGAGCGAT-3'
A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon sequences formed from this mRNA during the translation process?
A tRNA has an anticodon sequence 3′– GGU–5′. Identify the amino acidit is carrying?
All of the following apply to tRNAs EXCEPT: (more than one may apply) A. attach amino acids at the 5’ end B. have stems and loops C. are all encoded by a single gene D. an anti-codon of 5’AAC3’ corresponds to a codon of 3’UUG5’ E. exhibit distinctive 3D folds F. are acted on by 64 different aminoacyl synthetases G. are charged with amino acids by peptidyl transferase
Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon loop, the hydroxy-uridine and methylcytosine loops and a variable loop B. The tertiary structure of tRNAs is L-shaped C. All ERNAS contain anti-codons D. All TRNAS contain amino acids attached to the 3'-OH end E. All ERNAS contain the rare nucleotides, hydroxyuridine and methyl cytosine
TRNAS are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements regarding this process. The process is dependent on interactions between ribosomes and aminoacyl TRNA synthetases. The aminoacid is added to the D-loop of the tRNA. Aminoacyl TRNA synthetases are pre-associated with tRNAS. The amino acid is attached to the terminal to the 3' hydroxyl of an adenine in the acceptor arm. The process requires an aminoacyl-adenylate intermadiate. QUESTION 19 Select the correct statements regarding myosin-mediated contraction the sarcomere. O Ca2+ is required for the binding of myosin to f-actin. Myosin and f-actin are randomly distributed in the sarcomere. Physical pulling of the actin microfilament requires three distinct conformation changes on myosin that involve ATP binding, ATP hydrolysis and sequential release of inorganic phosphate and ADP. Myosin-mediated contracted is ubiquitous across all cell types. O O O O

Recommended textbooks for you

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781319114671

Author:

Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:

W. H. Freeman

Lehninger Principles of Biochemistry

Biochemistry

ISBN:

9781464126116

Author:

David L. Nelson, Michael M. Cox

Publisher:

W. H. Freeman

Fundamentals of Biochemistry: Life at the Molecul…

Biochemistry

ISBN:

9781118918401

Author:

Donald Voet, Judith G. Voet, Charlotte W. Pratt

Publisher:

WILEY

Biochemistry

ISBN:

9781305961135

Author:

Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Fundamentals of General, Organic, and Biological …

Biochemistry

ISBN:

9780134015187

Author:

John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson

Publisher:

PEARSON

SEE MORE TEXTBOOKS

Consider the translation of the following mRNA base sequence below during protein synthesis and identify the following: 5' CAA CGA AAG 3' 1. Codon/s associated with this base sequence 2. tRNA anticodons that are compatible with this base sequence 3. The amino acids specified by this base sequence