Consider the translation of the following mRNA base sequence below during protein synthesis and identify the following: 5' CAA CGA AAG 3' 1. Codon/s associated with this base sequence 2. tRNA anticodons that are compatible with this base sequence 3. The amino acids specified by this base sequence

Label the following regions on this tRNA molecule, stating the function of each:

The genetic code consists of a series of three-base wordsthat each code for a given amino acid.(a) Using the selections from the genetic code shown below, de-termine the amino acid sequence coded by the following seg-ment of RNA: UCCACAGCCUAUAUGGCAAACUUGAAG AUG= methionine ;CCU= proline; CAU= histidine ;UGG= tryptophan AAG= lysine ; UAU= tyrosine ;GCC= alanine ;UUG= leucine ;CGG= arginine ;UGU= cysteine ;AAC =asparagine ;ACA=threonine ;UCC= serine ;GCA=alanine ;UCA=serine(b) What is the complementary DNA sequence from which this RNA sequence was made? (c) If you were sequencing the DNA fragment in part (b), how many complementary chain pieces would you obtain in the tube containing ddATP?

The first nucleotide in mRNA that will be synthesized from DNA below is:  3'- ACGTATAGCCGGACGTCACTCGCTA-5' 5'-TGCATATCGGCCTGCAGTGAGCGAT-3'

A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon sequences formed from this mRNA during the translation process?

A tRNA has an anticodon sequence 3′– GGU–5′. Identify the amino acidit is carrying?

All of the following apply to tRNAs EXCEPT: (more than one may apply) A. attach amino acids at the 5’ end B. have stems and loops C. are all encoded by a single gene D. an anti-codon of 5’AAC3’ corresponds to a codon of 3’UUG5’ E. exhibit distinctive 3D folds F. are acted on by 64 different aminoacyl synthetases G. are charged with amino acids by peptidyl transferase

Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon loop, the hydroxy-uridine and methylcytosine loops and a variable loop B. The tertiary structure of tRNAs is L-shaped C. All ERNAS contain anti-codons D. All TRNAS contain amino acids attached to the 3'-OH end E. All ERNAS contain the rare nucleotides, hydroxyuridine and methyl cytosine

TRNAS are 'charged' or activated by aminoacyl TRNA synthetases. Select the correct statements regarding this process. The process is dependent on interactions between ribosomes and aminoacyl TRNA synthetases. The aminoacid is added to the D-loop of the tRNA. Aminoacyl TRNA synthetases are pre-associated with tRNAS. The amino acid is attached to the terminal to the 3' hydroxyl of an adenine in the acceptor arm. The process requires an aminoacyl-adenylate intermadiate. QUESTION 19 Select the correct statements regarding myosin-mediated contraction the sarcomere. O Ca2+ is required for the binding of myosin to f-actin. Myosin and f-actin are randomly distributed in the sarcomere. Physical pulling of the actin microfilament requires three distinct conformation changes on myosin that involve ATP binding, ATP hydrolysis and sequential release of inorganic phosphate and ADP. Myosin-mediated contracted is ubiquitous across all cell types. O O O O