Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:               5'AUGCGACCUAGCUAUGGA3'

Q: A) Draw the mRNA to be translated if the pre-mRNA is constitutively spliced. [ 3) Draw an mRNA to be…

A:

Q: What are the functional consequences of this deletion for lilP mRNA transcription and translation?…

A: Introduction :- A deletion mutation is a type of genetic mutation that involves the loss of one or…

Q: Find 5’ UTR and 3’UTR of Mrna 5’  AAACUGUGACUGAACCUCAAACCCCAAACCAGCCCGAGGAGAACCACAUUCUCCCAGGGA…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Based on your know | (hir sequence.

A: In many eukaryotic (and other prokaryotic) genes, the original RNA extracted from a genetic DNA…

Q: 6. Please describe the events that may result in a mature protein not having methionine as the…

A: DNA is the carrier for genetic information in almost all organisms except certain RNA viruses. DNA…

Q: 2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation…

A: DNA(deoxyribonucleic acid) is the genetic material in all the organisms except few viruses. The…

Q: m

A: DNA → RNA RNA → protein

Q: 1. The nontemplate strand of a segment of double- helical DNA contains the sequence:…

A: Since you have posted a question with multiple sub-parts, we will solve the first 2subparts for you.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Consider the MRNA sequence below. Assume that the following mRNA segment has been translated.…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: The following RNA sequence represents a small messenger which can be translated in a prokaryotic…

A: The first step in translating an RNA sequence into a protein is to divide the sequence into codons,…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: None

A: a) The informational strand (also known as the coding strand) of DNA is complementary to the…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: The RNA present in prokaryote and eukaryotic cells, where DNA is main genetic material, is called…

Q: Write a possible mRNA sequence that could code for each peptide. Note: Reference the Genetic code…

A: To provide the mRNA sequence for each of the given amino acid peptide, we will be using the Genetic…

Q: 28. a. Can a tRNA exist that has the anticodon sequence 5' IAA? If so, which amino acid would it…

A: Transfer RNA (tRNA) molecules contain a sequence of three nucleotides known as the anticodon. It is…

Q: On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in the course of…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: give the amino acids specified by the following bacterial mRNA sequences. a. 5′…

A: In the given question, the bacterial mRNA sequence is given for which we have to find the amino…

Q: Be sure to answer all parts. Consider the following mRNA sequence: 5'-GCU AGG CGA-3'. a. What amino…

A: Translation is the process in which the m rna is converted into a polypeptide chain of amino acids…

Q: The normal sequence of a protein is: Met – Thr – Lys – His – Ser – Ser ... Mutations of the DNA…

A: In this problem, the normal sequence of a protein is given, and three different protein sequences…

Q: D C 5' 3¹ A B Indicate True (T) or False (F) for the following statements. Only use the letter (T/F)…

A: Transcription is the process by which mRNA is synthesized from DNA. Translation is the process of…

Q: Explain the significance of the following statement: The functioning of the aminoacyl-tRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Copy the template strand…

A: DNA sequence is given. Top strand acts as template for mRNA synthesis. Top strand sequence is 3’…

Q: Use the sequence from the pre-mRNA shown below to answer the following question.…

A: Introduction :  The GU (5' splice site) and AG (3' splice site) recognise splice sites, signalling…

Q: None

A: The given DNA3' CACTACGGCGCTGCGTGACCGATCACAGTGCGT 5' 5' GTGATGCCGCGACGCACTGGCTAGTGTCACGCA 3'  In the…

Q: Which of the following statements about protein elongation are correct? I. There is a nucleophilic…

A: Replication, transcription and translation are basic mechanisms performed by genetic material along…

Q: 8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG…

A: To identify the locations within the ribosome during protein synthesis (translation) corresponding…

Q: 1. Explain why DNA fragments can be separated using an electric current. How does the size of the…

A: 1.DNA fragments can be separated by the application of current this process of separating DNA occurs…

Q: 1. b. What is the sequence of the mRNA produced from this gene? Label the 5' and 3' ends 5'…

A: Gene is a hereditary units that are involved in sending hereditary instructions from parents to…

Q: Given Sequence: 3’ – TACGGACTGATAGGCCCGCGCATC-5’ PLEASE PROVIDE THE RANSLATION OF THE FOLLOWING:…

A: The template strand is from 3` 5` and a coding strand of DNA is from 5` to 3`. The synthesis of m…

Q: Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the…

A:

Q: Determine each of the following items using the hnRNA nucleotide sequence (enter the answer using…

A: "Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Give the single letter translation for the protein encoded by this mRNA. Start with the start codon.…

A: DNA is the genetic material of the organisms which by the process of transcription forms mRNA. This…

Q: 1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that…

A: The amino acids in the given sequence are leucine, tyrosine, glycine, glycine, and valine.

Q: 4a. Was this micrograph taken of a sample prepared from human cells or prokaryotic cells? How do you…

A: Since you have posted a question with multiple subparts, we will solve the first three subparts for…

Q: Consider the following DNA mRNA sequence: 5’-ACTGATCCATGCCAGGGGTTTTCAACTAAAATGAAA-3’ a) What is the…

A: DNA carries the genetic information that is translated into mRNA and subsequently translated into…

Q: A normal mRNA that reads 5'- UGCCAUGGUAAUAACACAUGAAGGCCUGAAC-3' was an insertion mutation that…

A: mRNA Messenger RNA or mRNA, it is a single-stranded RNA molecule that is coded into chain of peptide…

Q: A. If a nascent mRNA is composed of 540 nucleotide bases and its introns (2/3 of the total number of…

A: .If m-RNA is composed of 540 nucleotides and 2/3 introns are removed during RNA splicing then we…

Q: C a 3' 5' exon intron exon intron exon intron untranslated region (UTR) coding sequence (CDS) Label…

A: Genes are the hereditary unit of an organism. It is inherited by the progeny from the parental…

Q: A. For each of the following nucleotide sequences, determine the amino acid sequence. 1. 5'…

A: Introduction Amino acids are molecules that combine to form proteins, They build muscles, prevents…

Q: Describe the prokaryotic translation initiation shown in the diagram. Define the convention of…

A: In bacteria initiation factor are required .Initiation factor 3(IF3) prevents 30S subunit binding to…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.