Anticodon Anticodon Anticodon 3 1 5'-IAG-3' 5'-UAU-3' 5'-AAA-3' codon MRNA 5'- -3' 5' _3' 3' 5' 3. 1 letter amino acid
Q: Small ribosomal sub-unit MRNA Codon Large Ribosomal sub-unit Amino acid Anticodon A C. D. F Three…
A: Nucleus is main controller of the cell which carries genetic material . It also contain thread like…
Q: How many tRNA molecules can associate with a ribosome at any given time during translation
A: The translation is the process of the formation of polypeptide chains of amino acids that lead to…
Q: What is the name for the complex that forms when many ribosomes translate the same MRNA at the same…
A: Polyribosomes are the complex of multiple ribosomes which translates the same mRNA.…
Q: sigma factor: promoter as O protein: DNA O mRNA: tRNA -35 element: GATCC element O elongation:…
A: Transcription is the process of making an mRNA copy of a gene (DNA). It is catalyzed by an enzyme…
Q: 21a. Fill in the blanks to label each type of molecule in this figure. asp a.TRNA b.amino acids leu…
A: The synthesis of proteins takes two steps: transcription and translation. Transcription takes the…
Q: 1c. Write in the specific ANTICODON and the specific AMINO ACID in the boxe This image on the right…
A: tRNA is called as transfer RNA and helps in transfer of information from the mRNA to protein (…
Q: spings gating its gen ISlation from this organism and use it to translate (in a test tube) some RNA…
A: The nucleotide in a DNA is a group which is arranged in a linear sequence in a DNA which contains…
Q: 1. For each of the sequences, place an X in the box to indicate the process most immediately…
A: Note: According to the guidelines, we are supposed to answer only one question. Please repost other…
Q: give the codon sequences of every code on this tRNA with the anti-codon 5AAG3, could pair with…
A: tRNA are transfer RNA which are responsible for decoding the information on mRNA for the synthesis…
Q: All of the following are stop codons, except 1. UAA 2. AUG 3. UAG 4. UGA
A: The template DNA strand is transcribed into mRNA on which the nucleotides are arranged in the form…
Q: The anticodon of a tRNA is 5' AAU 3' Part A What codon does the tRNA recognize? What amino acid does…
A: Transfer ribonucleic acid or tRNA is a small molecules which helps in translation of mRNA into…
Q: if the codon for Leucine is 5'-CUG-3'. what is the sequence of the corresponding anticodon on the…
A: A transfer RNA (tRNA) is a type of RNA molecule whose primary function is to match an mRNA codon…
Q: Which of the following anticodons can recognize BOTH codons for Aspartate (Asp)? Question 36…
A: The deoxyribonucleic acid (DNA) is the double-stranded molecule that is the genetic material in most…
Q: A tRNA in E. coli charged with His (histidine) would have the anticodon:
A: Translation -- the process of formation of proteins from the RNA tRNA are the type of RNA which…
Q: Codon in Codon in Amino Acid DNA template strand MRNA APP gene in individuals 3'-CAA-5' 5'-GUU-3'…
A: Alzheimer's disease causes the brain's atrophy to shrink and the cells of the brain to die. Dementia…
Q: xplain The mRNA codon of valine is: GUC UGG CCA TTG
A: Each codon in mRNA is made up of three nucleotides and represents a certain amino acid (hence, it is…
Q: Noncoding Strand -> 5’ - G C C A G G T C A G G T - 3’…
A: The terms used in the question represents the molecules involved in gene expression. A gene is a…
Q: Open reading frames... correspond to introns, which are not read by the ribosome during translation…
A: The genetic material has various components on which the transcriptional and translational machinery…
Q: Which amino acid is carried by the tRNA with the anticodon 5'-UCA-3'? None-this is a stop codon. OI.…
A: The process of translation helps in formation of long chains of amino acids ie, polynucleotides. We…
Q: 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Amino Acid 4. DNA (3'-5') AAG GTC…
A: Introduction: DNA: A deoxyribonucleic acid It is the hereditary molecule in the organisms except…
Q: Transcript the template DNA (write in mRNA codons) *
A: The synthesis of messenger RNA with the help of DNA is called transcription. The main enzyme of…
Q: MRNA 20 ORI 40 - FTCGAGCTCTCGTCGTCGAGATACGCGATGATATTACTGGHAATATOGGGATGCACTATC…
A: Gene expression includes transcription and translation. It leads to synthesize mRNA and protein…
Q: Give the amino acid sequence of the protein encoded by the mRNA in Figure 15.21.
A: Translation is the process of formation of protein by decoding the nucleotide sequence of an mRNA.…
Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?
A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…
Q: A tRNA that has the anticodon GAG carries which amino acid?
A: tRNA is a special kind of RNA molecule. It is also called transfer RNA. tRNA or transfer RNA is…
Q: Which of the following sequences would NOT be found as an anticodon in a tRNA? Question 35 options:…
A: The translation process that takes place in living cells helps the production of proteins from the…
Q: Give the anticodon of the tRNA that would be a "wobble match" for the codon 5'AGG3'.
A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…
Q: Assume that the nucleotide at the 5′ end of the first tRNA’s anticodon (the tRNA on the left) in…
A: The 61 codons codes code for 20 different amino acids. So, there must be 61 different tRNA…
Q: UACTyrosine (Tyr) Fcysteine (Cys) Consider the following DNA coding strand: 5' - ATGTACGGC GAATAA-3'…
A: Within the biological system, the flow of genetic information is explained as molecular biology's…
Q: Second letter A G UUU Phenyl- UUC alanine UAU UAC UGU UGC Oysteine UCU Tyrosine UCC Serine UUA UUG…
A: The genetic codon present in the mRNA will be translated during the translation process by ribosome…
Q: pc*00ATAAADDATATAJOTTAA 1. Use the genetic code table and the information in the diagram below to…
A: Translation, in molecular biology and genetics, is the process by which ribosomes in the cytoplasm…
Q: Mutated DNA Sequence #4 ТАСАС СТTGG CGACT АСТ... What's the mRNA sequence? (Circle the change) amino…
A: DNA is two stranded structure which make it own strand via replication process . It comprises of…
Q: 5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle…
A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a…
A: DNA => Transcription => mRNA => Translation => Protein Protein synthesis is ribosome…
Q: 新 22 e codon is 5' 5'-GAA-3'. O 3'-GAA-5'. 3'-CTT-5'. O 3'-CUU-5' O 5-CUU-3
A: An anticodon is a trinucleotide sequence that is complementary to a codon in an mRNA sequence.
Q: In the DNA segment 5'-ATGAGGCATGAGACG-3' (coding strand) 3'-TACTCCGTACTCTGC-5' (template strand)…
A: A DNA segment is generally a genomic feature recognized by anonymous DNA probes. Symbols for such…
Q: Basisse triplet nommer/ Base triplet number 1 2 3 4 5 6 7 Menslike DNA-volgorde /…
A: The order of nucleotides in the nucleic acid is referred to as nucleic acid sequence. The process of…
Q: TATACACCAGAGCCAGGCAATCCGTTA 8.1. Which strand functions as the transcription template, the top one…
A: The template strand of DNA serves as a template for synthesis of a complementary RNA transcript. The…
Q: DNA ONA 200000 700000 -MRNA Polypeptide- Chain Polypeptide- Chain Ribosome MRNA Ribosome Student 1…
A: The process of the formation of mRNA from the DNA strand is known as transcription. It is the first…
Q: Pre-MRNA 5' Cap Poly Codon numbers 105- 146 1-30 31-104 Introns cut out and exons spliced together…
A: The central dogma is a process that includes transcription (production of RNA from DNA) and…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…
A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…
Q: Table 9-2 Transcription of Oxytocin DNA Triplets ACG ATG TAT GTT TTG ACG GGA GAC C mRNA ACA AUC AUA…
A: A mRNA codon constitutes a group of three nucleotide bases. Each codon codes for a particular amino…
Q: 16. Translation codon termination in eukaryotes all except: B. UGA A. UAC C. UAG D. UAA
A: introduction Translation is the process of creating polypeptides from an mRNA transcript that was…
Q: 12. The following codons and the amino acids they encode is as follows: AUG = Met %3D UUU, UUC = Phe…
A: ANSWER;- a) The sequence of amino acids in the following structure Met-Phe-Leu-Ser-Thr-Pro b)(i) DNA…
Q: Fill in the blanks: The Lys60 (encoded by 5'-AAG-3' codon) of a protein is critical for its binding…
A: The ribonucleic acid or RNA is produced from these DNA by transcription process. Different types of…
Q: Describe Information Transfr Replicetion - Transcuiption Tronslation
A: Genes and genomes play an important role in information processing. The genetic material of the cell…
Q: tRNA with the anticodon 5'AGG3' carry
A: The basic constitutional unit of proteins is the amino acids. There are a total of 20 amino acids…
Q: 10.9 the beginning of a gene and five different mutations of this the base-pairing rules to complete…
A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…
Step by step
Solved in 4 steps
- A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein from its wil-type composition= lys-ser-pro-ser-leu-asn-ala-ala-lys mutant form= lys-val-his-his-leu-met-ala-ala-lys. Decipher the segment of mRNA for both the original protein and the double mutant. Which base was added? Which was deleted?Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G Cap aminoacyl tRNA synthetase proofreading elF4E [Choose ] Binds ribosome A site Translation initiation in eukaryotes Translation initiation in Bacteria binds mRNA cap in eukaryotes Binds ribosome E site Correct charging of a tRNA with amino acid Cap-independent translation initiation of some viral mRNAs [Choose ] [Choose ] [Choose ] [Choose ]Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
- First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?For the tRNA below, determine which amino acid it is charged with. attached amino acid G G GA 5' end c GOGGAUUU CUC G GAGC G C GCSAK & A 3' end ASSAGGCUUAA GACAC CCUGUG עכטט A GAAD anticodon C T U anticodon loop A G
- Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
- For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidFor the anticodon sequences 5' IAA, consider the DNA sequence of the gene encoding the tRNA, what is the sequence of the RNA-like strand of each tRNA gene that corresponds to the tRNA's anticodon? Be sure to indicate polarities.5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene