3' HO- a. 5' b. U, UH2 U. C. in

Q: Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while…

Q: The anticodon of a tRNA is 5' AAU 3' a. What codon does the tRNA recognize? b. What amino acid does…

A: BASIC INFORMATION  TRANSLATION  It is the process through which the proteins are made with the…

Q: During translation, the growing peptide chain resides in the P site of FRNA with the next amino acid…

A: Answer: CENTRAL DOGMA = This is the basic mechanism by which DNA is replicate and transcript in the…

Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr

A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…

Q: The first three codons for a mRNA sequence are 5’ GGC AAG UCU 3', What anticodons will the correct…

A: * mRNA that is also called as messenger ribonucleic acid is a single stranded RNA corresponds to…

Q: Describe the structure and function of tRNA

A: BASIC INFORMATION  RNA  It stands for Ribonucleic acid. They are of three types;  messenger RNA…

Q: During elongation, TRNA binds initially to the A "P" site on the ribosome. B any available site on…

A: tRNA also called the transfer RNA and is an adaptor molecule. tRNA molecule at as a link between…

Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: If the codon in the mRNA is 5' AUG', then the anticodon of the initiator tRNA is 5' CAT3' O 3' UAC5'…

A: CODON-  It is a unit of three nucleotides that forms a genetic code in a DNA/RNA.

Q: A tRNA with an ACC anticodon will insert the amino acid ________ during translation. A.Trp B.Arg…

A: tRNA or transfer RNA helps in decoding the sequence of mRNA into protein. It is structured to bind…

Q: Describe the structural features that all tRNA molecules have in common.

A: Introduction  tRNA is also referred as Transfer RNA which has a 3D structure like clover leaf. It…

Q: In an amino acyl-tRNA, the amino acid is attached to the tRNA through a(n) acid and the CCA sequence…

A: The translation is the process by which proteins are synthesized from mRNA through a sequence of…

Q: A tRNA is charged with the amino acid methionine.(i) Give the anti-codon of this tRNA.(ii) Write the…

A: Transfer RNAs (tRNAs) are the adaptor RNA molecules that serve to carry the amino acids from the…

Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…

A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…

Q: Consider the wobble rules listed in Table 15.2. An MRNA has the stop codon 5' UAA 3'. What TRNA…

A: Codon is a triplet of nucleotide base pairs.

Q: In a tRNA molecule, the anticodon loop refers to the site where the tRNA willI bind the mRNA. the…

A: Translation is the process in which proteins are synthesized by ribosomes.Translation occurs after…

Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…

A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…

Q: tRNA enzyme. Any given aminoacyl-tRNA synthetase: a. Attaches the amino acid to the 5′-end '5end of…

A: An anticodon is a RNA triplet complementary to the triplet on mRNA coding for their cargo amino…

Q: The anticodon loop of one of the t RNA Gly molecules from Escherichia coli is as follows: C--G G--C…

A: tRNA is a specialised RNA molecule that transports the amino acids during translation. A tRNA is…

Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…

A:

Q: The anticodon of a particular tRNA molecule is(A) complementary to the corresponding mRNA codon.(B)…

A: The heart of protein synthesis is the translation of nucleotide sequence information in the form of…

Q: In which of the ribosomal sites, the A site, P site, and/or E site, could the following be found? A.…

A: Ribosomes are small and round bodies that are either found floating freely in the cytoplasm, or…

Q: The tRNA having a cloverleaf structure suggests the following features EXCEPT

A: Answer - It is a single stranded linear structure with protein coding sequences.

Q: At least one nonsense suppressing tRNA is knownthat can suppress more than one type of…

A: tRNA is a transfer ribonucleic acid. It is a type of RNA which decodes the messenger RNA and form a…

Q: During initiation of translation, a                                  is positioned first at the…

A: The translation is the process of synthesis of proteins that occurs on the ribosomes in the…

Q: Which of the following statement(s) about "wobble" base is/are correct? Please make sure to select…

A: The tRNA and mRNA interaction occurs during the translation (protein synthesis) process. The tRNA…

Q: The anticodon loop of one of the tRNA Gly molecules from Escherichia coli is as follows: a)…

A: Anticodon is the sequence of nucleotides which is complementary to the codons. These are found on…

Q: In which site(s) of the ribosome could you find a tRNA with more than one amino acid bound (a…

A: Introduction :- The peptidyl transferase is an aminoacyltransferase and the principal enzymatic…

Q: The steps required for peptide elongation at the ribosome are, respectively, (A) initiation,…

A: The step of the protein biosynthetic pathway involved in the development of nascent polypeptide…

Q: Which part of a tRNA molecule acts as an amino acid attachment site?   a. the 5' end   b.…

A: tRNA (transfer ribonucleic acid) molecule escorts amino acids to their correct location in a…

Q: You are studying with a friend who says that the hydrogen-bonded portions of tRNA play no important…

A: tRNA is a short nucleotide RNA chain with L-shaped structure. A tRNA molecule is required for…

Q: The peptide bond formation is catalyzed by a. the aminoacyl tRNA synthetase b. tRNA c. the small…

A: Translation is a method or process by which the message on the messenger RNA is converted into a…

Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…

A: Translation is a orocess in which mRNA produce  protein by the help of ribosome and tRNA.there are…

Q: Label the features of a tRNA by dragging the labels to the correct targets. A Binds an amino acid B.…

A: tRNA is also known as transfer RNA which helps in the transfer of amino acid to the mRNA codon…

Q: TRNAS contain the that interacts with MRNA. docking bay b. anticodon а. C. codon

A: A transfer RNA is an adaptor molecule made of RNA that is typically 76 to 90 nucleotides long (in…

Q: Which site bound by a tRNA most of the time? O A P O E

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: Because of _____, a tRNA may recognize more thanone codon

A: codons of mRNA binds with anticodons of tRNA.

Q: The tRNA binding site on the ribosome is called Select one: a. E site b. P site c. E P A

A: Ribosomes are membrane less cell components involved in the process of translation (protein…

Q: A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: The tertiary structure of a tRNA is shown below. Using the various colored areas (i.e., red, yellow,…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide.the order…

Q: What site on the ribosome is the place where a tRNA molecule leaves the ribosome after attaching its…

A: BASIC INFORMATION  TRANSLATION  It is the process in which protein is which formed from the…

Q: which level of structure describes  non watson crick intercations in trna

A: According to Watson and crick, the DNA is a nucleotide, it is made up of sugar, nitrogenous base,…

Q: A mutation that changes a C to a T causes a type of Ehlers-Danlos syndrome, forming a “stop” codon…

A: Ehlers-Danlos syndrome is a most common genetic connective disorder causing the collagen of body to…

Q: Describe two special reaction sites on the tRNA

A: Full name of tRNA is transfer RNA. It acts as the supplier of amino acid to ribosome at the time of…

Q: The first aminoacyl-TRNA that binds to the ribosome: a. is a special fMet-tRNAet in prokaryotes. b.…

A: mRNA transcribed from nucleic acid will be translated into peptide sequence by ribosome. Ribosome…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA…

A:

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.