A) Based on the mRNA sequence below, provide the corresponding DNA template (5'-3') and protein sequences (N-C terminus) using the single letter abbreviations for each 5' GCA UAU CCU UGU GAU 3' B) Identify the two unique amino acids in the protein sequence above, provide their full names and brief explanation why you chose them C) Draw the two amino acids from 3. connected with a peptide bond to each other (with free amino and carboxy termini) at physiological pH

Q: Create an mRNA strand based on the given DNA template strand: TACTTCCTATTTTCTTGTCA CCGCACT Using the…

A: The process of synthesis of RNA with the help of DNA is called transcription and the process of…

Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…

A: DNA replication being very complex process, there are chances of miss reading the DNA template and…

Q: Three E. coli tRNA molecules with the anticodon sequences CGG, OGG , and UGG are charged with the…

A: During Protein synthesis or translation  that occurs in ribosomes, messenger RNA code for an amino…

Q: Consider the following 2 codons sequences. Codon sequence 1:  ACU AGA GAU GUC UGC Codon sequence…

A: β-sheets are formed by adjacent parallel or antiparallel peptide strands that are hydrogen bonded in…

Q: b. In superhelical proteins, such as collagen, several polypeptide helices are intertwined. What is…

A: Introduction  Protein is the key biomolecule in the biological system, any important physiological…

Q: Sequence: CUCAACACGCCGCUCAGUGCCCUCGUGAUGAAGCAUAGGGGAAAC   By in vitro translating the mRNA, you…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Q: 2.5 Which of the following is true about translation? A) The anticodon in the transfer RNA is…

A: t- RNA is called transfer RNA which changes to amino acyl RNA with help of the aminoacyl t-RNA…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide…

Q: B. A polypeptide has 51 amino acids in its primary structure. (i) What is the minimum number of DNA…

A: Introduction DNA resides in the sequence of four nucleotides. The genetic code is a triplet code…

Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'

A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…

Q: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a…

A: In cell protein formed according to the sequence on mRNA. mRNA is formed from DNA sequence by the…

Q: Which amino acid repeat pattern would most likely form a stable a-helix with one hydrophobic side?…

A: Amino Acids are biochemical molecules that combine to make proteins; as a result, they are referred…

Q: 5' UGG CAA UCC UAC GAU 3' < Is it possible for a single base pair substitution to cause a truncation…

A: Yes,  it is possible for  a single base pair substitution to cause a truncation in the peptide as…

Q: following RNA strand. CGCUACAUCUUU b. If a gene mutation results in a frame shift, meaning the RNA…

A: A) The output from the given nucleotide sequence is RYIF which is Arginine&gt;Tyrosine&gt;…

Q: If a tRNA has an anticodon sequence 5'-CAU-3', What would be an amino acid carried by that tRNA?

A: Codon is defined as the the group of three nucleotides that encode an amino acid.

Q: 1. Using the table of the genetic code, determine the sequence of amino acids. 2. If mutation occurs…

A: Codons are triplets of nucleotides in the mRNA sequence, which is read by the ribosomes in order to…

Q: Ôn the space provided, type the translation product of wild-type gene A (use three- letter…

A:

Q: Shown below is a portion of a DNA sequence ( 31 base pairs long ) that encodes the last amino acids…

A: The process of synthesis of messenger RNA with the help of template DNA strand is called…

Q: From this overall anticodon sequence in tRNA,…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: N' C' = Polypeptide X d a b = SRP 5'- = translocator e Which region(s) of polypeptide X would bind…

A: Ribosomes refer to the site where the protein synthesis takes place. It comprises rRNA and protein.…

Q: How do you seal sequence 2 (from 5' end) to the 3' end of the sequence 1 in vitro condition? Design…

A: Sealing is the joining of two DNA (deoxyribonucleic acid) segments under in-vitro conditions. The…

Q: In the given segment 3 ’ C A G T T A C G G C T C C T A G G T T A T A A T T C G T T T C  5 ’…

A: DNA replication occurs with the help of several enzymes and is always synthesized in 5' to 3'…

Q: ermine the sequence of amino acids specified by the codons in the following information strand. G…

A: The synthesis of RNA with the help of the DNA strands is called transcription and the translation is…

Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…

A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…

Q: (a) dues in the polypeptide. Place the label or an arrow on the Ca atom of both residues. Label the…

A: Proteins are composed of amino acids, which are bound together by peptide linkage. Amino acids…

Q: (a) How many activation cycles are needed for a protein with 150 amino acids? (b) How many…

A: The process of translation or protein synthesis occurs in the cytoplasm of a cell in both…

Q: 30  A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…

Q: From this overall anticodon sequence in tRNA,…

A: Anticodon present on the tRNA and it is read in the direction 3'→5' which is complementary to the…

Q: Given the following sequence of a coding DNA strand: AGTTGCGCATGCCAGAGAGGTTCGAGTGCACATAACTTGAG The…

A: DNA is a double stranded molecule with coding strand and template strand. Template strand is the one…

Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…

A: Introduction:  Mutations are changes in the genetic material or character of an organism. It can…

Q: Like a helices, B sheets often have one side facing the surface of the protein and one side facing…

A: Alpha-helices and beta-sheets are examples of protein secondary structures. Secondary structure…

Q: TGTACACATGTCCGAAACAGACTTACCGAA-5

A: For the given DNA Sequence , the translated mRNA  is as follows_  3'TGTACACATGTCCGAAACAGACTTACCGAA5'…

Q: 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this…

A: Introduction DNA is a self replicating molecule. DNA synthesis occurs during the S phase of the cell…

Q: A polypeptide has 51 amino acids in its primary structure. (i)  What is the minimum number of DNA…

A: Protein or polypeptides are the polymers of amino acids and these amino acids are synthesized by…

Q: I only need letter D

A: Deoxy ribonucleic acid (DNA) is the genetic material that contains genetic material in the form of…

Q: If Kd= 100 nM, [RNA] = 10 nM, and [protein] = 1 uM a) What fraction of RNA is bound? b) What…

A: The interaction between the protein and RNA occurs through hydrogen bonding, electrostatic and…

Q: 17. How would you computationally predict the thermodynamic stability of a long, extended RNA helix?…

A: Thermodynamic stability is the state when the structure is in a conformation that has the lowest…

Q: 1. A DNA base sequence transcribed into messenger RNA in the following sequence:…

A: Introduction :- Transcription is the process through which synthesis of mRNA molecules takes place ,…

Q: 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand:…

A: Transcription is the process of synthesis of mRNA by using a template DNA strand. Translation is the…

Q: Position on the small and large ribosomal subunits which the peptidyl-tRNA occupies prior to peptide…

A: The DNA (deoxyribonucleic acid) is the genetic material of an organism. The DNA is transcribed to…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…

A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…

Q: 1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU…

A: DNA replication is a proces by which molecule of DNA is duplicated. DNA replication is necessary to…

Q: Determine the sequence of amino acids specified by the codons in the following information strand.…

A:

Q: Indicate the amino acid sequence of the protein encoded by the following mRNA molecule.  Use the…

A: Transcription is the process in which the synthesis of RNA takes place by using deoxyribonucleic…

Q: Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi…

A: Transcription is the process by which the genetic information in the DNA segment is copied into an…

Q: Determine the sequence of a polypeptide treated with trypsin and chimotripsine. Below are the…

A: The sequence are:

Q: In the tertiary structure of tRNA, where is the anticodon region relative to the attachment site for…

A: tRNA is the transfer RNA and an adapter molecule made up of RNA serving as the physical link between…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.