NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?

Q: 17.56 The following sequence is a portion of the DNA template strand: TGT GGG GTT ATT a. Write the…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: What is the expected molecular weight of the protein encoded by the sequence provided here:

A: A protein is formed by various amino acids linked together by peptide bonds. By knowing the number…

Q: peptide bond formation is catalizyed at the larger ribosomal subunit. does this happend in…

A: Translation includes three phases: initiation, elongation, and termination. Initiation is a phase in…

Q: includes

A: A new Covid, known as serious intense respiratory disorder Covid 2 (SARS-CoV-2), is the aetiological…

Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?

A:

Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr

A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…

Q: Show tRNAs with their anticodons bound to met and gly codons first without taking wobble into…

A: The discussion at hand centers on the complex and crucial process of translation that occurs in…

Q: What are aminoacyl-tRNA synthetases?

A: A protein or polypeptide sequence is biosynthesized during translation inside a live cell. The…

Q: DNA in human mitochondria encodes 22 different tRNA molecules. However, 32 different tRNA molecules…

A: Mitochondrial gene expression maintain cellular homoeostasis. Mitochondrial gene expression is…

Q: Which enzymes and tRNAs are known as aminoacyl-tRNA synthetases?

A: BASIC INFORMATION ENZYMES They are the catalyst. They help in accelerating the chemical reaction.…

Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop

A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…

Q: The structures of tRNAs contain several unusual bases in addition to the typical four. Suggest a…

A: The transfer RNA or tRNA acts as an adaptor molecule that is responsible for decoding the codons,…

Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'

A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…

Q: Assume that the translational error frequency, d, is 1 * 10–4. (a) Calculate the probability of…

A: The probability that a protein molecule is completely error free is (1-δ)n, where n is the number of…

Q: Remembering that the amino acid side chains projecting from each polypeptide backbone in a β sheet…

A: Amongst secondary structures of polypeptide chains made of amino acids, β-sheets are a more spacious…

Q: Define aminoacyl tRNA synthetase

A: Nucleic acids are biological macromolecules that are essential to all known forms of life as they…

Q: Describe the two sequential reactions that occur in the activesite of aminoacyl-tRNA synthetases.

A: This two-step reaction of aminoacyl-tRNA synthetases occurs during the process of protein synthesis.

Q: On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in the course of…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA…

A: Introduction: Enzymes are the catalysts that increase the rate of the reaction that occurs inside…

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: A polyhistidine-tag or better known by its trademarked name His-tag is an amino acid motif present…

A: In vectors used to produce recombinant proteins, the DNA sequence defining a string of six to nine…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: What are isoaccepting tRNAs?

A: Transfer ribonucleic acid (tRNA) is required during the translation process for the synthesis of…

Q: The enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure…

A: Enzyme is a catalytic molecule that increases the rate of any chemical reaction without being used…

Q: What is the name for Gly-Tyr-Leu-Val Sequence?

A: Biomolecules are organic molecules made up of mainly carbon and hydrogen but there are other…

Q: Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit,…

A: Ribonucleoproteins form the basic unit of ribosomes and they are a complex of RNA and proteins. They…

Q: Ribosomal proteins have high pI values. Why is this advantageous for ribosome stability?

A: Ribosome is the complex of rRNA and proteins present in the cytoplasm of a cell. It is responsible…

Q: Assume that the translational error frequency, δ, is 1 x 10–4.(a) Calculate the probability of…

A: mRNAs are used to form protein by translation. The translation is performed using ribosomes, t-RNA…

Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…

A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…

Q: Describe the charging process of a tRNA.

A: A form of RNA molecule known as tRNA aids in the translation of a mRNA into a specific protein.…

Q: What amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met…

A: tRNA stands for the transfer RNA and it has L- shaped structure . Transfer RNA acts as an adopter…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.