NA has an anticodon sequence 3′– GGU–5′. Identify the amino acid it is carrying?

Q: 17.56 The following sequence is a portion of the DNA template strand: TGT GGG GTT ATT a. Write the…

A: As per the central dogma of molecular biology, genetic information is stored in the DNA. The genetic…

Q: Determine whether this statement is true or false: Aminoacyl-tRNA synthetase covalently links the…

A: Transfer RNA, often known by the acronym tRNA and formerly known as soluble RNA (sRNA), is an…

Q: peptide bond formation is catalizyed at the larger ribosomal subunit. does this happend in…

A: Translation includes three phases: initiation, elongation, and termination. Initiation is a phase in…

Q: Aminoacyl-tRNA synthetase joins amino acids to their cognate trna. Briefly discuss the two reactions…

A: Aminoacylation is mechanism of attachment of amino acid to tRNA. Aminoacyl-tRNA synthetase joins…

Q: What is thee tRNA anticodon for the first 5’-ACGAUC-3’?

A:

Q: List anticodon sequences on the tRNA’s carrying the amino acids: Ala, Phe, Leu, Tyr

A: In the process of translation, the mRNA-carrying codons are coded into the anticodons, which help to…

Q: Show tRNAs with their anticodons bound to met and gly codons first without taking wobble into…

A: The discussion at hand centers on the complex and crucial process of translation that occurs in…

Q: What are aminoacyl-tRNA synthetases?

A: A protein or polypeptide sequence is biosynthesized during translation inside a live cell. The…

Q: Name the GREEN structure of the tRNA Variable loop D-loop Anticodon loop Pseudouridine loop

A: According to the messenger RNA (mRNA) nucleotide sequence, transfer RNAs (tRNAs), also known as…

Q: Describe the structure and function of tRNA

A: BASIC INFORMATION  RNA  It stands for Ribonucleic acid. They are of three types;  messenger RNA…

Q: Write the names of the appropriate regions on L-shaped structure of TRNAS. 13' 15'

A: The process of protein synthesis involves transcription and translation. In transcription, DNA is…

Q: Suppose that there is an unknown protein that underwent Edman sequencing method. From N- terminal…

A: Sequencing of proteins is done by treating Proteins with different enzymes that have specificity in…

Q: Define aminoacyl tRNA synthetase

A: Nucleic acids are biological macromolecules that are essential to all known forms of life as they…

Q: What is the primary difference betwee class I and class II aminoacyl-tRNA synthetases.   a. Class…

A: An enzyme that synthesizes tRNAs by amino acid polymerization is called an aminoacyl-tRNA synthetase…

Q: Describe the two sequential reactions that occur in the activesite of aminoacyl-tRNA synthetases.

A: This two-step reaction of aminoacyl-tRNA synthetases occurs during the process of protein synthesis.

Q: Using threonyl-tRNA synthetase as an example, account for the specificity of threonyl-tRNA…

A: Introduction: Enzymes are the catalysts that increase the rate of the reaction that occurs inside…

Q: Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG.…

A: Given,Original Codon Sequence: AUGACCCGGCUACUGMutant Codon Sequence: AUGACCCGGUUACUGOriginal Protein…

Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: For the tRNA below, determine which amino acid it is charged with. attached amino acid DD GA G 5'…

A: Several biological molecules in animals are tiny and simple, with just one or a few functional…

Q: Find self-complementary regions in the following RNA sequence: AUGUGGCAUGCCAGG

A: Biomolecules includes carbohydrates, lipids, nucleic acids and proteins. Nucleic acid plays an…

Q: Give the amino acid sequence with some little explanation please.   5′…

A: Decoding a sequence of bases in mRNA results in the formation of either peptide, polypeptide, or…

Q: The enzyme thiouridylase converts certain tRNA uridine residues to 2-thiouridine. Draw the structure…

A: Enzyme is a catalytic molecule that increases the rate of any chemical reaction without being used…

Q: Give the anti-codon of this Trna?

A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…

Q: Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit,…

A: Ribonucleoproteins form the basic unit of ribosomes and they are a complex of RNA and proteins. They…

Q: Give the coordinate for the last base of the first exon for tra-RB; type a number as in 7,000…

A: Introduction :  In mRNA transcripts, introns are referred to as interfering sequences. These are the…

Q: For the anticodon sequences  5' IAA, consider the DNA sequence of the gene encoding the tRNA, what…

A: Transfer RNA is a RNA which is used in the protein synthesis or translation process. It carries a…

Q: Shown in the following table are several amino acid substitutionsin the a and b chains of human…

A: Globins are considered an ancient and varied superfamily of proteins. Hemoglobin is an major protein…

Q: For the following DNA bases, give the complementary mRNA code that would be transcribed from these…

A: The process of formation of m RNA with the help of DNA is called transcription. During the formation…

Q: Describe the charging process of a tRNA.

A: A form of RNA molecule known as tRNA aids in the translation of a mRNA into a specific protein.…

Q: What amino acid would a tRNA with anticodon CUA carry? Enter the 3 letter code only [A]. [e.g. Met…

A: tRNA stands for the transfer RNA and it has L- shaped structure . Transfer RNA acts as an adopter…

Q: Metenkephalin is a small peptide found in animal brains that has morphine-like properties. Give an…

A: DNA is transcribed into mRNA. The mRNA contains a tripeptide sequence known as codons that code for…

Q: 5'- ATTGTGATATGGCCACCTGCCACCTGGAGAGCAGCT GATTAG-3' What oligopeptide is encoded by the above…

A: The DNA contain genes (functional unit) that encode protein molecules. Proteins are the "workhorses"…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.