Microbiology With Diseases By Taxonomy (6th Edition)
6th Edition
ISBN: 9780134832302
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 2VI
Summary Introduction
To label:
The portions that likely have a higher ratio of G-C base pairs and the portion that have a higher ratio of A-T base pairs.
Introduction:
There are two types of nitrogenous bases: purines and pyrimidines. These bases pair with their complementary bases and form a
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Look at the double-stranded segment of DNA shown below. Imagine that the two strands have already been denatured, and the temperature has been decreased to an appropriate annealing temperature. Show where the two primers would anneal to the strands, then indicate the direction of extension on each new strand with an arrow.
5’--T C A G G A C G T A A G C T T G C A T A T C T C G A T G C T A A A T C A T—3’
3’--A G T C C T G C A T T C G A A C G T A T A G A G C T A C G A T T T A G T A—5’
Primer #1: 3’ A C G A T T T 5’
Primer #2: 5’ G G A C G T A 3’
Supercoiled DNA is slightly unwound compared to relaxed DNA and this enables it to assume a more compact structure with enhanced physical stability. Describe the enzymes that control the number of supercoils present in the E. coli chromosome. How much would you have to reduce the linking number to increase the number of supercoils by five?
The following is the base sequence of DNA that codes for first eight amino acids of the β chain of hemoglobin. The β chain of hemoglobin contains a total of 147 amino acids so this is a small part of the entire gene.
DNA Template Strand: TACCACGTGGACTGAGGACTCCTC
1. What is the minimum number of DNA nucleotides in this whole gene?
2. What is the sequence of bases on the strand of DNA that is complementary to the template strand? 3. What mRNA will be formed from the template strand of DNA?
Chapter 7 Solutions
Microbiology With Diseases By Taxonomy (6th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - In bacteria, polypeptide translation can begin...Ch. 7 - Prob. 3TMWCh. 7 - Prob. 4TMWCh. 7 - Clinical Case Study Deadly Horizontal Gene...Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MCCh. 7 - Prob. 4MCCh. 7 - Prob. 5MC
Ch. 7 - Prob. 6MCCh. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - Prob. 9MCCh. 7 - Prob. 10MCCh. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- DNA Polymerase Holoenzyme IIlI is represented below. It consists of several domains with distinct functions. The structure capable of 5' to 3' DNA polymerization is represented by the letter and the structure capable of 3' to 5' exonuclease activity is represented by the letter B. -D DNA Pol II holoenzyme D; A А; С А;B А А; D В; D O Oarrow_forwardthis is the worst figure i have ever seen. Evidently A and B are different but the same color? From what I understand A would be a sliding clamp, and B is Primase? Is F rna primer (I think personally) or representing the SSBP? this is the worst diagram ever. the words that are for labeling are as follows: DNA polymerase III, sliding clamp, helicase, single-stranded binding protein (SSBPs), topoisomerase, RNA primer, newly synthesized DNA, primase, and DNA ligase.arrow_forwardWrite down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'arrow_forward
- DNA Polymerase Holoenzyme Ill is represented below. It consists of several domains with distinct functions. The structure that provides high processivity (processivity factor) is represented by the letter and the structure that provides DNA proofreading function is represented by the letter A В. -C -D DNA Pol III holoenzyme В; D А; А А; D D; A A; Carrow_forwardwhose properties suggest that they originated from transfer of foreign DNA into a bacterial cell.arrow_forwardUse a drawing to illustrate the principle of DNA gel electrophoresis. (2 marks)-+arrow_forward
- All are correct about DNA gyrase in E. coli EXCEPT: It works to remove positive supercoiling introduced by the DnaB protein (helicase). It is a topoisomerase that hydrolyzes ATP during its reaction mechanism. Its mechanism involves the breaking of a single phosphoester bond in one strand of dsDNA. It works to relieve supercoiling in DNA to overcome the torsion stress imposed upon unwinding.arrow_forwardOn paper, replicate the following segment of DNA: (UPLOAD PHOTO OF YOUR ANSWER) 5' ATCGGCTACGITCAC 3' 3'TAGCCGATGCAA GTG 5'arrow_forwardGiven the following template DNA strand, what is the correct complementary DNA sequence? 3' CGC AGT GGA CAT TTC 5'arrow_forward
- Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.arrow_forwardIn order to replicate both strands of DNA SIMULTANEOUSLY , E. coli bacteria folds or loops one strand so both strands can do 5' to 3' synthesis. True Falsearrow_forwardChoose reactions that always require hydrolysis of ATP. Select all that apply. sliding along template strands unwinding of DNA strands by helicase formation of the phosphodiester linkage by DNA ligase unwinding of DNA strands by B2 subunits formation of the phosphodiester linkage by DNA polymerase Iarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License