Microbiology With Diseases By Taxonomy (6th Edition)
6th Edition
ISBN: 9780134832302
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 7, Problem 6FIB
Summary Introduction
Introduction:
Operons are characteristic feature of prokaryotes but these are absent in eukaryotes. Operon comprises of multiple genes arranged together with a promoter and an operator.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Orca is a new type of E. Coli bacterium. Suppa is a nutrient that Orca needs to survive. Suppa can be synthesized by four (4) enzymes (SupA, SupB, SubC, and SupD) in its cell or it can acquire it from its environment. It only synthesizes it's own Suppa when it's really desperate, because there's none around!
Draw and describe Orca's operon controlling its synthesis of Suppa.
When referring to attenuation in the regulation of the trp operon it would be safe to say that, when there are high levels of tryptophan available to the organism, ________.
tryptophan inactivates the repressor protein
translation termination of the trp operon is likely
the trp operon is transcribed at relatively high levels
the ribosomes stall during translation of the attenuator region
transcription termination at the attenuator region is likely
The process in which the two-dimensional structure of RNA from the L region of an operon can either prevent or allow transcription of the structural genes is called _____________.
Group of answer choices
Activation
Co-repression
Induction
Attenuation
Repression
Chapter 7 Solutions
Microbiology With Diseases By Taxonomy (6th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - In bacteria, polypeptide translation can begin...Ch. 7 - Prob. 3TMWCh. 7 - Prob. 4TMWCh. 7 - Clinical Case Study Deadly Horizontal Gene...Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MCCh. 7 - Prob. 4MCCh. 7 - Prob. 5MC
Ch. 7 - Prob. 6MCCh. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - Prob. 9MCCh. 7 - Prob. 10MCCh. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The symbols a, b, and c in the table below represent theE. coli lac system genes for the repressor (I ), the operator(O) region, and the β-galactosidase (Z), although notnecessarily in that order. Furthermore, the order inwhich the symbols are written in the genotypes is notnecessarily the actual sequence in the lac operon.Activity (+) or inactivity (−) of Z geneGenotype Inducer absent Inducer presenta- b+ c+ + +a+ b+ c- + +a+ b- c- - a+ b- c+/a- b+ c- + +a+ b+ c+/a- b- c- - +a+ b+ c-/a- b- c+ - +a- b+ c+/a+ b- c- + +a. Which symbol (a, b, or c) represents each of the lacgenes I, O, and Z ?b. In the table, a superscript minus sign on a gene symbolmerely indicates a mutant, but some mutant behaviorsin this system are given special mutant designations.Using the conventional gene symbols for the lac operon,designate each genotype in the table.arrow_forwardIn the lac operon, the product of structural gene lacZ is capable of ________. producing zinc finger nucleases transporting lactose into the cell repressing the lactose operon forming lactose from lactose precursors cleaving the lactose disaccharide into glucose and galactosearrow_forwardThe lac operon has 4 genes, I, Z, Y and A. For each scenario, tell me the result of the mutation, what would happen if this mutant was in the presence of lactose and why. A) Lac I is mutated/not functional - B) Lac Y is mutated/not functional -arrow_forward
- If tryptophan is presence in the culture media of E.coli then _________. the promoter will be accessed by the RNA polymerase the repressor will bind to the operator the structural genes of the trp operon will be expressed tryptophan will be synthesizedarrow_forwardWhat if there was a mutation in the operator region of the lac operon and the active repressor could not bind there? How would this affect the cell’s production of β–galactosidase?In general, Histone acetylation makes DNA ___________________, while DNA methylation makes DNA ________________.arrow_forwardAssuming that the level of glucose is low, a mutation in the repressor associated with the lac operon of E. coli which prevents binding of the repressor to lactose should result in_____ Constitutive expression of the lac operon genes ito sagot ko Lack of expression or reduced expression of the lac operon genes under all circumstances Expression of the genes only when lactose is present Expression of the genes only when lactose is absentarrow_forward
- Figure 5 shows the lac operon structure in Escherichia Coli What will happen if substance S is absent in the medium?arrow_forwardDo you expect operons to occur extensively in Eukaryotes? Yes or no and explain.arrow_forwardThe following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forward
- In addition to observing similarities to the lac operon, you also notice that this gene is regulated via attenuation, similar to the trp operon. Based on this similarity to this model operon, you could state that ___________. Group of answer choices If a terminator loop forms in the DNA, the expression of the structural genes is halted. The formation of the terminator hairpin followed by a series of Uracil (UUUUUUU) functions similar to Rho-Independent termination to result in the stopping of transcription. The transcription of a leader sequence affects the translation of the structural genes. Never mind – all of these statements are true! Attenuation will be the primary means of transcriptional regulation, with a repressor used as a back up option.arrow_forwardRegarding the trp operon: when levels of tryptophan are low, the ___ hairpin forms, resulting in _____ of transcription. Group of answer choices 2-3; termination 3-4; termination 3-4; continuation 2-3; continuationarrow_forwardIf glucose is absent, but lactose is available, the lac operon will be _______arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license