Microbiology With Diseases By Taxonomy (6th Edition)
6th Edition
ISBN: 9780134832302
Author: Robert W. Bauman Ph.D.
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 7, Problem 1SA
Summary Introduction
To determine:
The way in which the genotype of a bacterium determines its
Introduction:
The genome of a cell includes its entire genetic complement including genes and
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
How important and useful to the cell is the ability of the DNA to assume various forms? Why are these various forms necessary? make an essay type answer
Transcribe the following DNA sequence. Then translate the resulting mRNA transcript.
GGACTACGTTCAAAAGCCATGGATTCGGTA
Transcription:
Translation:
What would be the result of the following mutations in the DNA sequence above? How would the polypeptide change? How would you characterize this mutation? (Nucleotides are numbered from left to right.)
a) nucleotide number 16 changes from a G to an A
b) nucleotide number 12 changes from an A to a T
c) nucleotide number 8 changes from a G to an A
d) an insertion of a C between nucleotides 14 and 15.
True or false: bacterial cells may contain multiple genomes?
Chapter 7 Solutions
Microbiology With Diseases By Taxonomy (6th Edition)
Ch. 7 - DNA replication requires a large amount of energy,...Ch. 7 - In bacteria, polypeptide translation can begin...Ch. 7 - Prob. 3TMWCh. 7 - Prob. 4TMWCh. 7 - Clinical Case Study Deadly Horizontal Gene...Ch. 7 - Which of the following is most likely the number...Ch. 7 - Which of the following is a true statement...Ch. 7 - Prob. 3MCCh. 7 - Prob. 4MCCh. 7 - Prob. 5MC
Ch. 7 - Prob. 6MCCh. 7 - Prob. 7MCCh. 7 - Prob. 8MCCh. 7 - Prob. 9MCCh. 7 - Prob. 10MCCh. 7 - Which of the following is not a mechanism of...Ch. 7 - Prob. 12MCCh. 7 - Prob. 13MCCh. 7 - Which of the following are called jumping genes?...Ch. 7 - Prob. 15MCCh. 7 - Prob. 16MCCh. 7 - Prob. 17MCCh. 7 - Prob. 18MCCh. 7 - Prob. 19MCCh. 7 - Prob. 20MCCh. 7 - Prob. 21MCCh. 7 - Prob. 22MCCh. 7 - Prob. 23MCCh. 7 - Prob. 24MCCh. 7 - The trp operon is repressible. This means it is...Ch. 7 - The three steps in RNA transcription are...Ch. 7 - Prob. 2FIBCh. 7 - Prob. 3FIBCh. 7 - Prob. 4FIBCh. 7 - An operon consists of ____________,...Ch. 7 - Prob. 6FIBCh. 7 - A daughter DNA molecule is composed of one...Ch. 7 - Prob. 8FIBCh. 7 - Prob. 9FIBCh. 7 - ____________ is a recombination event that occurs...Ch. 7 - Prob. 11FIBCh. 7 - Prob. 12FIBCh. 7 - Prob. 1SACh. 7 - Prob. 2SACh. 7 - Prob. 3SACh. 7 - Polypeptide synthesis requires large amounts of...Ch. 7 - Prob. 5SACh. 7 - Prob. 6SACh. 7 - Prob. 7SACh. 7 - Prob. 8SACh. 7 - Describe how DNA is packaged in both prokaryotes...Ch. 7 - Prob. 10SACh. 7 - Prob. 11SACh. 7 - Prob. 12SACh. 7 - On the figure below, label DNA polymerase I, DNA...Ch. 7 - Prob. 2VICh. 7 - Prob. 3VICh. 7 - If molecules of mRNA have the following nucleotide...Ch. 7 - A scientist uses a molecule of DNA composed of...Ch. 7 - Prob. 3CTCh. 7 - Prob. 4CTCh. 7 - Prob. 5CTCh. 7 - Suppose that the E. coli gene for the lac operon...Ch. 7 - Prob. 7CTCh. 7 - Prob. 8CTCh. 7 - Prob. 9CTCh. 7 - How can knowledge of nucleotide analogs be useful...Ch. 7 - The endosymbiotic theory states that mitochondria...Ch. 7 - Prob. 12CTCh. 7 - Prob. 13CTCh. 7 - Prob. 14CTCh. 7 - What DNA nucleotide triplet codes for codon UGU?...Ch. 7 - Prob. 17CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Discuss the similarities and differences between DNA and RNA. Be specific and use your own words. Answer in 2 to 3 paragraphs. Thank you.arrow_forwardConsider Molecule X in the sketch below: protein- ribosome X What is the name of X? Your answer should be one word, or a short two- or three-word phrase. Spelling counts. Note: if there is more than one possible answer, separate each answer with a comma. 0arrow_forwardPut the following in order from smallest to largest: nucleotide,genome, nitrogenous base, gene, nucleus, cell, codon, chromosome.arrow_forward
- Make a nucleosome by circling the DNA and protein locations.arrow_forwardb) Use the DNA sequence bęlow to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence.arrow_forwardUse the following information to answer the next question. The DNA strand shown below is thought to contain the genetic code for part of an enzyme B-galactosidase which is involved in lactose metabolism. (Read the DNA beginning at the left.) -A-T-A-T-G-G-G-G-C-A-T-G The second amino acid coded from the section of DNA for B-galactosidase is Select one: a. thymine b. tryptophan c. serine d. threoninearrow_forward
- "Nucleosomes bind DNA so tightly that they cannot move from the positions where they are first assembled" is true or false.arrow_forwardThe sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. ССТАССТТАТGCСАAGTTGGGGATАААСТС The left end of this molecule is the end. How many amino acids will be in the protein translated from this sequence? What is the name (not abbreviation) of the fourth amino acid in the protein translated from this sequence? The label on the end of the protein that is translated first is th v end. 5' Please answer all parts of the question. carboxyl 3' aminoarrow_forwardConsider the following DNA sequence: -T -- -- If RNA primase used this section of DNA to make a primer, what would be the correct sequence of base pairs (from top to bottom)? T-A-C-C-G-T-T OT-U-C-C-G-U-U OA-T-G-G-C-A-A U-A-C-C-G-U-Uarrow_forward
- The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2.Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide.arrow_forwardTranslate this nucleotide sequence into an amino acid sequence. Gene Sequence (5'-to-3'):…arrow_forwardInside the nucleus of a eukaryotic cell you will find DNA associated with proteins. This combination of protein and DNA is knownarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license