Biology: Concepts and Investigations
5th Edition
ISBN: 9781260259049
Author: Hoefnagels
Publisher: MCG
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 7, Problem 15WIO
Refer to the figure to answer these questions:
a. Add labels for mRNA (including the 5' and 3' ends) and tRNA. In addition, draw in the RNA polymerase enzyme and the ribosomes, including arrows indicating the direction of movement for each.
b. What are the next three amino acids to be added to polypeptide b?
c. Fill in the
d. What is the sequence of the DNA complementary to the template strand (as much as can be determined from the figure)?
e. Does this figure show the entire polypeptide that this gene encodes? How can you tell?
f. What might happen to polypeptide b after its re lease from the ribosome?
g. Does this figure depict a prokaryotic or a eukaryotic cell? How can you tell?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
Below is a list of functions related to
protein synthesis. Place the number for the
function in the blank above its
corresponding structure.
1. Copies the genetic code from DNA and
carries it to the ribosomes
2. Splits DNA into two strands and
transcribes MRNA from the antisense
strand
3. Carries amino acids to the ribosome
4. Area on DNA antisense strand that RNA
polymerase binds to begin transcription
Promoter
MRNA
RNA
TRNA
region
polymerase
Please consider the figure below.
a. Give the name of the process illustrated in the figure.
b. If this is part of the elongation stage, explain what is going to happen next. Use the labels, A, B, C and/or D to answer the question.
C. What terminus of the protein is represented by the amino acid represented by label D?
Chapter 7 Solutions
Biology: Concepts and Investigations
Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MCCh. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MCCh. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?
Ch. 7.4 - What is the role of RNA polymerase in...Ch. 7.4 - What are the roles of the promoter and terminator...Ch. 7.4 - How is mRNA modified before it leaves the nucleus...Ch. 7.5 - How did researchers determine that the genetic...Ch. 7.5 - What happens in each stage of translation?Ch. 7.5 - Where in the cell does translation occur?Ch. 7.5 - How are polypeptides modified after translation?Ch. 7.6 - What are some reasons that cells regulate gene...Ch. 7.6 - Prob. 2MCCh. 7.6 - Prob. 3MCCh. 7.6 - Prob. 4MCCh. 7.7 - What is a mutation?Ch. 7.7 - What are the types of mutations, and how does each...Ch. 7.7 - Prob. 3MCCh. 7.7 - Prob. 4MCCh. 7.7 - How are mutations important?Ch. 7.8 - What question about the FOXP2 gene were the...Ch. 7.8 - What insights could scientists gain by...Ch. 7 - A nucleotide is composed of all of the following...Ch. 7 - Prob. 2MCQCh. 7 - Transcription copies a _______ to a complementary...Ch. 7 - Choose the DNA sequence from which this mRNA...Ch. 7 - Prob. 5MCQCh. 7 - Prob. 6MCQCh. 7 - How does the lac operon regulate lactose digestion...Ch. 7 - Prob. 8MCQCh. 7 - Prob. 9MCQCh. 7 - Prob. 10MCQCh. 7 - Explain how Griffiths experiment and Avery,...Ch. 7 - Prob. 2WIOCh. 7 - Prob. 3WIOCh. 7 - Put the following in order from smallest to...Ch. 7 - Prob. 5WIOCh. 7 - List the three major types of RNA and their...Ch. 7 - Some people compare DNA to a blueprint stored in...Ch. 7 - Prob. 8WIOCh. 7 - Prob. 9WIOCh. 7 - If a protein is 1259 amino acids long, what is the...Ch. 7 - Prob. 11WIOCh. 7 - The roundworm C. elegans has 556 cells when it...Ch. 7 - A protein-encoding region of a gene has the...Ch. 7 - Explain how a mutation in a protein-encoding gene,...Ch. 7 - Refer to the figure to answer these questions: a....Ch. 7 - Describe the mutation shown in figure 7.27 and...Ch. 7 - Prob. 17WIOCh. 7 - Parkinson disease causes rigidity, tremors, and...Ch. 7 - Refer to figure 7.28 and the chapter con tent to...Ch. 7 - Prob. 2PITCh. 7 - Prob. 3PITCh. 7 - Prob. 4PIT
Additional Science Textbook Solutions
Find more solutions based on key concepts
Identify each of the following reproductive barriers as prezygotic or postzygotic. a. One lilac species lives o...
Campbell Essential Biology with Physiology (6th Edition)
Why is it necessary to be in a pressurized cabin when flying at 30,000 feet?
Anatomy & Physiology
1. The correct sequence of levels forming the structural hierarchy is
A. (a) organ, organ system, cellular, che...
Human Anatomy & Physiology (Marieb, Human Anatomy & Physiology) Standalone Book
How does trandlation differ from transcription?
Microbiology: Principles and Explorations
2. Why is it that the range of resting blood pressures of humans is best represented by a bell-shaped curve co...
Human Biology: Concepts and Current Issues
Match the people in column A to their contribution toward the advancement of microbiology, in column B. Column ...
Microbiology: An Introduction (13th Edition)
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Use the pre-mRNA sequence shown below to answer the following questions. MRNA: 5'ACUGGACAGGUAAGAAUACAACACAGUCGGCACCACG 3' a. Underline the 5' and 3' splice sites, then write the sequence of the spliced mRNA in the space provided. b. Predict what would happen if the G in the 5' splice site were mutated to a C. c. We learned in this topic that the 5' cap in an mRNA plays a role in translation initiation. What do you think is one plausible mechanism by which a 5' cap can enhance initiation ? How can you experimentally demonstrate that a 5' cap is important for this process ?arrow_forwardWhich sequences are spliced out of the mRNA strand before leaving the nucleus? In other words, which sequences are not part of the code for the amino acids? a. exons b. intronsarrow_forwardA particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA synthase. What happens when an mRNA transcript contains the codon for this tRNA? A. The tRNA will not bind to this codon. B. Translation stops and the protein is released. C The wrong tRNA is added to the protein chain. D. Translation stops and the protein remains bound to the ribosome.arrow_forward
- For each of the following, identify the type of RNA involved (mRNA, rRNA, or tRNA). a. Transports the correct amino acid to the ribosome, using the information encoded in the mRNA. b. Is a major component of ribosomes. c. Specifies the order of amino acids in a protein, using a series of three-base codons, where different amino acids are specified by particular codons. d. Contains a three-base anticodon that pairs with a complementary codon revealed in the mRNA. e. Assists in making the bonds that link amino acids together to make a protein.arrow_forwardThe following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' O b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3' QUESTION 37 The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What sequence of amino acids would be produced as a result of transcribing and translating this DNA template? a. Met - Asn - Leu - Phe - His - [STOP] Ob. Tyr - Arg - Met - Phe - Thr - [STOP] O C. Asn - Pro - Leu - Val - Arg - Tyr d. Met - Phe - Thr - [STOP] e. None of the above O O O Oarrow_forwardGiven: 3' TAC CAG TTA AGC CTC GGT ATC CAG GAT ACG 5' What would be the first 10 bases at the 5' end of the complementary strand? A. 5' TCG CGTATC C 3' C. 5' GGC TTA ACT G 3' E. none of the choices B. 5' ATG GTC AATT 3' D. 5' CGT ATC CTG G 3' WRITE THE CAPITAL LETTER OF YOUR ANSWER.arrow_forward
- The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' O e. 5' - AAUCCACUUGUACGCUAU - 3'arrow_forwardGiven the following non-coding strand of DNA nucleotides:G T T C C C T T T G G A A C C T G G Write the nucleotide sequence of the coding strand of DNA:b. Write the nucleotide sequence of mRNA resulting from transcription:c. Using the genetic code, write the amino acid sequence translated:arrow_forwardSelect the description of an intron. (If possible, please explain why it is that answer) a.) sequence of adenine nucleotides added onto the end of pre‑mRNA b.) modified form of a guanine nucleotide added onto the end of pre‑mRNA c.) coding portion of a DNA sequence that is present in mature mRNA d.) noncoding portion of a DNA sequence that is removed from pre‑mRNAarrow_forward
- Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two copies of the gene has the disease, but a person with one copy of the gene does not have the disease. The diagram shows how this mutation affects an organism. Use the image to answer the question. Which conclusion can you draw based on the diagram? A. The mutation changed the amino acid sequence during the translation step. B. A mutation caused the information in DNA to change during the transcription step. C. A change in the DNA sequence can be carried over to the translation and transcription steps. D. The change that affected the translation and transcription steps does not affect the organism.arrow_forwardGiven the following DNA strand: TACAGAGATAACCGAATT A. Write the corresponding strand that would form the other half of the DNA molecule. B. Transcribe the original DNA strand (TACAGAGATAACCGAATT) and write the sequence of bases found in the resulting messenger RNA molecule. C. Translate your messenger RNA molecule and write the sequence of amino acids in the resulting protein (the genetic code is provided below).arrow_forwardb) Use the DNA sequence bęlow to answer the following questions. 3' - TACGAACGAGTGCCCCAAAATT -5' What is the complementary DNA strand? What is the nucleotide sequence of the mRNA strand transcribed from the initial DNA strand? Provide an alternative mRNA sequence with four changes that would translate to the same amino acid sequence.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY