Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two copies of the gene has the disease, but a person with one copy of the gene does not have the disease. The diagram shows how this mutation affects an organism. Use the image to answer the question. Which conclusion can you draw based on the diagram? A. The mutation changed the amino acid sequence during the translation step. B. A mutation caused the information in DNA to change during the transcription step. C. A change in the DNA sequence can be carried over to the translation and transcription steps. D. The change that affected the translation and transcription steps does not affect the organism.

Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two copies of the gene has the disease, but a person with one copy of the gene does not have the disease. The diagram shows how this mutation affects an organism. Use the image to answer the question. Which conclusion can you draw based on the diagram? A. The mutation changed the amino acid sequence during the translation step. B. A mutation caused the information in DNA to change during the transcription step. C. A change in the DNA sequence can be carried over to the translation and transcription steps. D. The change that affected the translation and transcription steps does not affect the organism.

Name: Sickle cell anemia is a disease caused by a mutation at the genotypic
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Sickle cell anemia is a disease caused by a mutation at the genotypic level. A person with two copies of the gene has the disease, but a person with one copy of the gene does not have the disease. The diagram shows how this mutation affects an organi

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 15P: Recombination in Immunoglobulin Genes If recombination between a Vkand Jkgene formed a CCA codon at...

See similar textbooks

Similar questions

The haemoglobin proteins of RNA polymerase ii sub units RPB1-P24928 RPB2-P30876 RPB3-P19387 RPB4-015514 are they similar? Explain?
Given the sequence below, (A) What is the transcript (MRNA) sequence? (B) What is the amino acid sequence of the translated peptide? Rather than using abbreviations, write out the entire name of each of the amino acids in your peptide, so you do not risk using the wrong abbreviation and, therefore, providing the wrong sequence. 5' - ATG CTT GTA ATA CCG TGA - 3'
GTTTTCACTGGCGAGCGTCATCTTCCTACT 8. What is the function (e.g. transcriptional regulation, transmembrane signaling, kinase, protease, etc.) of the protein(s) encoded by the gene.
Anti apoptosome anti N anti protein X anti caspase based on thé data above where is the WT protein actually cleaved D380 D380 and D835 D835 D835 and D840 D840 all are cleaved none are cleaved D380 and D840 if you compared the size of WT and the D380E mutant before apoptosis on a western blot how would they appear? D380E would be larger they would be indistinguishable WT would be larger how many amino acids long is the larger band in the lane labeled D380E/D835E
Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preserved
Apol (5322) Apal (5258) lacl ApoI (4612) tac promoter pGEX-6P-1-INIA 6347 bp PstI (3301) Ampicillin GST C3 cleavage site Apal (941) Bam HI (946) Pst I (1091) Pst I (1412) inlA funct dom Pst I (1937) NotI (2339)
An important mechanism for generating diversity in immunoglobulin light chain V-region sequences is based on the fact that the RAG recombinase generates hairpin structures, rather than blunt ends, at the cleavage sites between the recombination signal sequences and the coding sequences. Explain how this mechanism generates diversity at the junctions.
In BLOSUM62 matrix, a conserved Tryptophan position has score S(W,W) = 11, but a conserved Leucine position has score S(L,L) = 4. Give at least one reason why these values differ.
describe SARS-CoV2 Spike Protein
Explain the signifi cance of the observation that peptides such as fMet-Leu-Phe “activate” the phagocytotic (particle-engulfi ng) functions of mammalian leukocytes (white blood cells).
Name conditions caused by abnormalities of vertical linkages and horizontal (lateral) linkages in RBC transmembrane and cytoskeletal proteins.
can you please help me out with this ? Mutations in the IL2RG gene cause approximately 30 percent of severe combined immunodeficiency disorder (SCID) cases in humans. These mutations result in alterations to a protein component of cytokine receptors that are essential for proper development of the immune system. The IL2RG gene is composed of eight exons and contains upstream and downstream sequences that are necessary for proper transcription and translation. Below are some of the mutations observed. For each, explain its likely influence on the IL2RG gene product (assume its length to be 375 amino acids). Nonsense mutation in a coding region Insertion in Exon 1, causing frameshift Insertion in Exon 7, causing frameshift Missense mutation Deletion in Exon 2, causing frameshift Deletion in Exon 2, in frame (g) Large deletion covering Exons 2 and 3