The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What MRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' b. 5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3'

The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What MRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' b. 5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3'

Name: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT -
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would beproduced from transcribing this DNA template strand?a. 5' - TATCGCATGTTCACCTAA - 3'b.5' - UAUCGCAUGUUCACCUAA - 3'c. 5' - AUGUUCACCUAA - 3'd. 5' - UTGTTCUCCTUU

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 6RQ: A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA...

See similar textbooks

Similar questions

A promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNA
What is the sequence of the DNA template strand from which each of the following mRNA strands was synthesized? a. 5 '–UGGGGCAUU–3 ' c. 5 '–CCGACGAUG–3 'b. 5 '–GUACCU–3 ' d. 5 '–GUAGUCACG–3 '
The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced from transcribing this DNA template strand? a. 5' - TATCGCATGTTCACCTAA - 3' O b.5' - UAUCGCAUGUUCACCUAA - 3' c. 5' - AUGUUCACCUAA - 3' d. 5' - UTGTTCUCCTUU - 3' e. 5' - AAUCCACUUGUACGCUAU - 3' QUESTION 37 The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What sequence of amino acids would be produced as a result of transcribing and translating this DNA template? a. Met - Asn - Leu - Phe - His - [STOP] Ob. Tyr - Arg - Met - Phe - Thr - [STOP] O C. Asn - Pro - Leu - Val - Arg - Tyr d. Met - Phe - Thr - [STOP] e. None of the above O O O O
f the template strand of DNA has the sequence 5’-TCTAGGACT-3’, what will the sequence of the transcribed RNA be? A. 5’-AGAUCCUGA-3’ B. 5’-UCAGGAUCU-3’ C. 5’-AGUCCUAGA-3’ D. 5’-AGATCCTGA-3’ E. 5’-UCAGGATCT-3’
A DNA antisense strand contains the following nucleotide base sequence: ATC CAA GAC TGG From this, what is the nucleotide sequence of the MRNA strand that is transcribed? a. ATC CAA GÁC TGG b. TAG GTT CTG ACC c. UAG GUU CUG ACC d. AUC CAA GÁC UGG
Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'
A DNA antisense strand contains the following nucleotide base sequence: ACG TTT ATG GGT From this, what is the nucleotide sequence of the MRNA strand that is transcribed? a. TGC AAA TAC CCA b. UGC AAA UAC CCA C. AGC UUU AUC CCU d. ACG UUU AUG GGU
A DNA antisense strand contains the following nucleotide base sequence: AGT GTC TTT GAC From this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. AGU GUC UUU GAC b. UCU CUG UUU CAG UCA CAG AAA CUG d. TCA CAG AAA CTG C. How many amino acids does the mRNA strand above code for? .
Which of the following DNA molecules is complementary to the sequence: 5'-ATTGCGTAC - 3¹? O a. 5'-TAACGCATG-3' O b.5'-AUUGCGUAC-3' O c. 5'- UAACGCAUG - 3' O d. 5'- GTACGCAAT - 3' O e. 5'- UTTGCGTUC - 3¹
A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter strand. What will the sequence of the primer be? A. ATCGTTAGCGT B. ATGGTTAGGGT C. AUCGUUAGCGU D. AUCGTUAGCGT
A DNA antisense strand contains the following nucleotide base sequence:CGA TTT GGT TGAFrom this, what is the nucleotide sequence of the mRNA strand that is transcribed? a. CGA UUU GGU UGA b. GCU AAA CCA ACU c. GCA AAA CCA ACT d. CGA TTT CCA ACT
Using the coding strand of a DNA molecule below, what will the first 6 bases of the template strand be? 5’ ATAGATGAAGCCCCACGCCTA 3’ (coding strand of DNA) 3’ 5’ (template strand or non-coding strand of DNA) 5’ 3’ (mRNA strand) a. UAUCUA b. GCGAGT c. TATCTA