A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is A U G which codes for amino acid methionine.

Question

Want to see the full answer?

Answer 1

Question

Chapter 7, Problem 5MCQ

Summary Introduction

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

a. If a single transition occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? b. If a single transversion occurs in a codon that specifies Phe, what amino acids can be specified by the mutated sequence? c. If a single transition occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence? d. If a single transversion occurs in a codon that specifies Leu, what amino acids can be specified by the mutated sequence?

8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5" A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. What is the amino acid sequence that would result from translation of B.) the MRNA resulting from the sequence? See Codon Table on next page. 20 C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? D.) If the fourth nucleotide in the DNA sequence were deleted due to a mutation during DNA replication, what would the resulting amino acid sequence be? What type of mutation is this? E.) What impact would the mutation in the DNA sequence in PART D have on the function of the protein produced from original sequence? Why?

Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…

Answer 2

Question

Chapter 7, Problem 5MCQ

Summary Introduction

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 3

Question

Chapter 7, Problem 5MCQ

Summary Introduction

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 4

Question

Chapter 7, Problem 5MCQ

Summary Introduction

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 5

Chapter 7, Problem 5MCQ

Summary Introduction

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Answer 6

Chapter 7, Problem 5MCQ

Summary Introduction

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Answer 7

Chapter 7, Problem 5MCQ

Summary Introduction

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Answer 8

Expert Solution & Answer

Answer 9

Expert Solution & Answer

Answer 10

Want to see the full answer?

Check out a sample textbook solution

See solution

Answer 11

Ch. 7.1 - How did Griffiths research, coupled with the work...Ch. 7.1 - How did the Hershey-Chase blender experiments...Ch. 7.2 - What are the components of DNA and its...Ch. 7.2 - What evidence enabled Watson and Crick to decipher...Ch. 7.2 - Prob. 3MC Ch. 7.3 - What is the relationship between a gene and a...Ch. 7.3 - Prob. 2MC Ch. 7.3 - What are the three types of RNA, and how does each...Ch. 7.4 - What happens during each stage of transcription?Ch. 7.4 - Where in the cell does transcription occur?

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is A U G which codes for amino acid methionine.

Solution Summary: The author explains that a codon contains three DNA or RNA molecules and is responsible for initiation and termination of protein synthesis.

Concept explainers

Videos

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Want to see the full answer?

Chapter 7 Solutions

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is A U G which codes for amino acid methionine.

Solution Summary: The author explains that a codon contains three DNA or RNA molecules and is responsible for initiation and termination of protein synthesis.

Concept explainers

Videos

Introduction: A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.

Want to see the full answer?

Chapter 7 Solutions

Introduction:

A codon is a specific sequence of nucleotide that either contains three DNA or RNA molecule. It is responsible for initiation and termination of protein synthesis. Codon is different for different amino acid. Start codon is AUG which codes for amino acid methionine.