Biochemistry: Concepts and Connections (2nd Edition)
2nd Edition
ISBN: 9780134641621
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 11P
DNA from a newly discovered virus was purified, and UV light absorption was followed as the molecule was slowly heated. The absorbance increase at the melting temperature was only 10%. What does this result tell you about the structure of the viral DNA?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
A scientist isolates the DNA genome from a virus. She attempts to
carry out a melting analysis but finds only 10% hypochromicity.
(a) Suggest an explanation for the low value.
(b) Why do you think she finds this much?
If a virus particle contained double-stranded B-DNA of 400,000 base pairs,
A. What would be the length (in Angstroms) of the DNA before packing into the virus?
B. What would be the radius of the DNA fiber before packing into the virus?
A scientist uses a molecule of DNA composed of radioactive nucleotides as a template for replication and transcription in a nonradioactive environment.
a) What percentage of individual strands of DNA will be radioactive after three (3) DNA replication cycles?
2. b) What percentage of RNA will be radioactive?
Chapter 4 Solutions
Biochemistry: Concepts and Connections (2nd Edition)
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - a. What two enthalpic factors stabilize DNA in...Ch. 4 - 19.
a. The plasmid pBR322 (4362 base pairs) was...Ch. 4 - Prob. 20PCh. 4 - What DNA sequence feature is required for a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- You are studying RNA viruses and have discovered one that grows well in a culture of eukaryotic cells. You know that the virus is a single-stranded RNA virus, but you don't know if it is positive or negative stranded. Your lab-mate says, "Well, just treat your cell culture with cyclohexamide and see if the virus replicates its genome." You know that cyclohexamide inhibits protein elongation by binding to eukaryotic ribosomes. What is the basis of your lab-mate's suggestion?arrow_forwardSince DNA is a hydrophillicmoelcule, it cannot pass through cell membranes. Name and explain the technique with which the DNA is forced into (ii) a bacterial cell (ii) a plant cell (iii) an animal cell.arrow_forwardYou have begun your career in medicinal biochemistry and have just discovered a bacterial DNA plasmld (transferabl ring of DNA) that appears to destroy the Ebola virus. In order to characterize your new plasmid, the molar mass of the plasmid must be determined. You dissolve 25.00 mg of the purified plasmid in 0.200 mL of water at 2 °C and find the osmotlc pressure of this solution is 1.20 Torr at 20 °C and 1 atm pressure. Answer the following about the Ebola-killing plasmid. 33.) The osmotlc pressure of the system is: (a) 1 atm (b) 0.016 atm (c) 6.5 X 10-5 atm (d) 22.59 atm (e) 0.0016 atmarrow_forward
- in the gel than a A DNA molecule that is 1000 base pairs in length would go molecule that is 200 base pairs in length. A) further B) you cannot tell from the information provided C) the same distance D) not as fararrow_forward2) Replicating structures in DNA can be observed in the electron microscope. Regions being replicated appear as bubbles. a) How many replication forks are present? b) Assuming bidirectional replication, how many origins of replication are active in this DNA molecule? c) Assuming that all replication forks move at the same speed, which origin of replication was activated first (left, middle or right)? Why?arrow_forwardGiven the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?arrow_forward
- The FDA finds that chickens across the US are infected with a new type of bird-flu. They determine the sequence coding for the virus's surface proteins and see that some chickens' viruses have code (I) and some chickens' viruses have code (II). (I) 5' CAUGAUAUUGUACUUU 3' (II) 5' GAAUGGAACUGCAACUC 3' What type of nucleic acid does this virus have? O DNA O RNA O RNA-DNA Hybrid O FRNA O TRNAarrow_forwardExplain the following statement : a) initiation of bacteriall DNA replication is an energy requiring process b) bacterial DNA polymerase can enter the termination sequence but cannot exisarrow_forwardPrimer needed to initiate DNA replication is A) DNA segment B) RNA segment C) DNA-RNA hybrid D) Nucleotidearrow_forward
- There are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).arrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardSome antibiotic drugs fight infection by interfering with DNA replication, transcription, or translation in bacteria. Indicate whether each of the following antibiotic drug effects is on replication, transcription, or translation. HINT Each answer (replication, transcription, and translation) is used only once for the following: a. Rifampin binds to bacterial RNA polymerase. b. Streptomycin binds bacterial ribosomes, disabling them. c. Quinolone blocks an enzyme that prevents bacterial DNA from unwinding.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
What Is A Virus ? ; Author: Peekaboo Kidz;https://www.youtube.com/watch?v=YS7vsBgWszI;License: Standard YouTube License, CC-BY