Biochemistry: Concepts and Connections (2nd Edition)
2nd Edition
ISBN: 9780134641621
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 12P
Would you expect Neurospora crassa DNA to have a higher or lower Tm than human DNA (see page 81)? Explain.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The DNA from sea urchins contains about 32% A and about 18% G. What percentages of T and C would you expect in sea urchin DNA? Explain.
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below.
pGGCGACCGATTAGTCCCATCGATGGG−OH
The sequences of several short single-stranded DNA
molecules are shown below. Imagine each sequence as
a typical double-stranded DNA molecule, with
antiparallel strands held together by Watson-Crick base-
pairs between the complementary bases. Which of
these double-stranded molecules would have the
highest melting temperature (Tm)?
5' ACTGAGTCTCTGACTAGTCT 3'
5' ACTTAGTCTATGACTAGTCT 3'
5' ACTTAATCTATGAATAGTCT 3'
5' ACTGCGTCTCCGACTAGTCT
3'
5' ACTGCGTCTCCGACGAGCCT 3'
Chapter 4 Solutions
Biochemistry: Concepts and Connections (2nd Edition)
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - a. What two enthalpic factors stabilize DNA in...Ch. 4 - 19.
a. The plasmid pBR322 (4362 base pairs) was...Ch. 4 - Prob. 20PCh. 4 - What DNA sequence feature is required for a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- With regard to Chargaff’s experiment described in Figure shown,answer the following:A. What is the purpose of paper chromatography?B. Explain why it is necessary to remove the bases in order todetermine the base composition of DNA.C. Would Chargaff’s experiments have been convincing if theyhad been done on DNA from only one species? Discuss.arrow_forwardIn sheep DNA, the mol % of adenine (A) was found to be 28.3. Based on Chargaff's rule, what would be the approximate mol % of G, C, and T? mol % of G = mol % of C = mol % of T =arrow_forwardThe relative proportions of cytosine-guanine and adeninethymine bonds in a DNA sample can be estimated by measuring its “melting temperature,” the temperature at which half of the DNA strands have pulled apart. Samples with a high percentage of cytosine-guanine pairs have a higher melting temperature than samples with a high percentage of adeninethymine pairs. Explain why this is so, considering the nature of the bonds that hold the base pairs together (look back at as shown).arrow_forward
- The DNA of a skin sell and a muscle cell are identical. But the skin cell may contain the proteins collagen and keratin in high amount, which the muscle lacks (or has very little of), while the muscle cell may have large amounts of the proteins actin and myosin, which the skin cell lacks (or has very little of). Explain this apparent contradiction.arrow_forwardEthanol promotes bonding between Na+ ions from the salt and charged phosphate group of the DNA due to a higher dielectric constant than water. True or False?arrow_forwardThe two sides of the DNA double helix are connected by pairs of bases (adenine, thymine, cytosine, and guanine). Because of the geometric shape of these molecules, adenine bonds with thymine and cytosine bonds with guanine. The figure (Figure 1) shows the thymine-adenine bond. Each charge shown is ±e, and the H−N distance is 0.110 nm . Calculate the net force that thymine exerts on adenine. To keep the calculations fairly simple, yet reasonable, consider only the forces due to the O−H−N and the N−H−N combinations, assuming that these two combinations are parallel to each other. Remember, however, that in the O−H−N set, the O− exerts a force on both the H+ and the N−, and likewise along the N−H−N set. Express your answer in newtons. Is the net force attractive or repulsive?arrow_forward
- Given the findings of biochemist Erwin Chargaff about the composition of DNA. Answer the following questions: (1) What is your general observation on their findings? (2) Why are the proportions of the nitrogen bases of human thymus and human sperm almost the same?arrow_forwardWhat observations are consistent with the conclusion that DNA serves as the genetic material in eukaryotes? List and discuss them.arrow_forwardA plot showing the % of denautration as a function of temperature for a melting point of a DNA sample under 0.12 M NaCl gives an equation of a line of Y= 0.0074 X - 0.044 (Where Y is the % of denautration and X is the temperature in degree C) This is all the information that was given. 1. Calcuate the melting point of this DNA in degree Carrow_forward
- The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 10° D. In your answers, show how you came up to each result? (a) How many base pairs does this bacterium contain? (b) How many full double-helical turns does this DNA contain? (c) How long is this DNA in µm?arrow_forwardAn analysis is performed to determine the proportions of each of the four nucleotide bases in the DNA of several tissue samples from various species. The results appear in the table. Human Chicken Yeast E. coli % Adenine % Guanine (A) (G) 31 20 28 21 32 18 26 25 % Thymine % Cytosine (T) 30 29 33 24 Which conclusions can be drawn from this data? (C) 19 22 17 25 The proportion of G is roughly equal to the proportion of C. The proportion of A is roughly equal to the proportion of T. The proportion of pyrimidines is roughly equal to the proportion of purines. The proportion of A-T base pairs is roughly equal to the proportion of G-C base pairs.arrow_forwardUsing the first and second base key below, predict the DNA sequence given by the SOLID color sequence. For the key G = green, R = red, Y = yellow, and B = blue. Note that the first base of the sequence is already given ("A"). Give the remaining 8 bases for this sequence. A First base A CCT Second base A CGT BGY R GBRY RBG R Y (G) B Y G)(R) GB )( R )( Y ) ( G) Barrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Heredity: Principles and Issues (MindTap Co...BiologyISBN:9781305251052Author:Michael CummingsPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Human Heredity: Principles and Issues (MindTap Co...
Biology
ISBN:9781305251052
Author:Michael Cummings
Publisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license