Biochemistry: Concepts and Connections (2nd Edition)
2nd Edition
ISBN: 9780134641621
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 7P
For some DNAs, it is possible to separate the two strands, after denaturation, in a CsCl gradient.
a. What property of any DNA determines where it will band in a CsCl?
b. What kind of DNA might have two strands that differ sufficiently in this property that they could be separated after denaturation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a) What property of any DNA determines where it will band in a CsClgradient?(b) What kind of DNA might have two strands that differ sufficiently in thisproperty that they could be separated after denaturation?
One of the useful rules of thumb that you may have learned in Biochemistry, is that a 50 g/ml solution of DNA has an absorbance of about 1.0 in a 1 cm cell.
A. I have a solution of DNA that has a transmittance of 0.15 when it is placed in a cell with a 200 um pathlength. What is the concentration of DNA in this solution? (in units of g/ml)
B. Assume that this DNA is a synthetic oligo containing 25 base pairs, and that the MW of a single base pair has a molecular weight of 330. What is the molar concentration of duplex DNA molecules in the solution?
C. What is the Molar absorptivity of DNA in units of L cm (mol base pair) -1 -1
Suppose the following base sequence was found in a 20-base DNA polymer.
3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5'
a. What would be the first 5 bases at the 3' end of the complementary strand?
b. What would be the first 10 bases at the 5' end of the complementary
strand?
c. Assuming the presence of the complementary strand, what is the
percentage composition of the polymer with respect to the A-T base pair?
with respect to the G-C base pair?
d. In the given segment in problem 1, illustrate and indicate the direction of the
synthesis of:
i. a 5-nucleotide RNA primer
ii. a 5-nucleotide Okazaki fragment
Chapter 4 Solutions
Biochemistry: Concepts and Connections (2nd Edition)
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - a. What two enthalpic factors stabilize DNA in...Ch. 4 - 19.
a. The plasmid pBR322 (4362 base pairs) was...Ch. 4 - Prob. 20PCh. 4 - What DNA sequence feature is required for a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Do any strands of nucleic acid exist in nature in which part of the strand is DNA and part is RNA? If so, a.describe when such strands of nucleic acid are synthesized. Is the RNA component at the 5' end or at the 3' end?arrow_forwardDNA solution is viscous because of the nature of chemical substance that can intercalate into the DNA helix. An example of such substance is acridine orange. experiments revealed that acridine orange causes an increase in the viscosity of DNA solution.how would you account for this effect?arrow_forwardExplain how DNA-binding proteins can make sequence-specific contacts to a double-stranded DNA molecule without breaking the hydrogen bonds that hold the bases together. indicate how, through such contacts, a protein can distinguish a T-A from a C-G pair. indicate the parts of the nucleotide base pairs that could form noncovalent interactions— hydrogen bonds, electrostatic attractions, or hydrophobic interactions -with a DNA-binding protein.arrow_forward
- The complementary strands of DNA in the double helixare held together by hydrogen bonds: G ≡ C or A = T.These bonds can be broken (denatured) in aqueous solutions by heating to yield two single strands of DNA(see Figure 1-13a). How would you expect the relativeamounts of GC versus AT base pairs in a DNA doublehelix to affect the amount of heat required to denatureit? How would you expect the length of a DNA doublehelix in base pairs to affect the amount of heat requiredto denature it?arrow_forwardEthanol promotes bonding between Na+ ions from the salt and charged phosphate group of the DNA due to a higher dielectric constant than water. True or False?arrow_forwardConsider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?arrow_forward
- Assume that a poly(A) tract five base pairs long produces a 20° bend in aDNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA)5 tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helixarrow_forwardif this DNA has a molecular weight of 1.20 ×108 Dalton which contains a head in a about 200 nm long. Calculate the length of the DNA assuming the molecular weight of a nucleotide pair is 600 Dalton and assume that the DNA is a B-form and that there are 10 base pair per turn which makes is 34 Å per turn. ( 1nm = 10Å)arrow_forwardThe underlying structure of DNA is very simple, consisting of only four possible building blocks. a. How is it possible for DNA to carry complex genetic information if its structure is so simple?arrow_forward
- The High Mobility Group (HMG) proteins are architectural regulators of DNA. Many HMG proteins are phosphorylated at certain serine residues. How would phosphorylation change the binding affinity of HMG proteins to DNA?arrow_forwardThe first 15 bases of the original coding informational strand of DNA (which continues after what is shown) are 5-ATGAAACCCGGGTTT(...)-3'. Which of the following mutations to this original strand would be silent and which would likely only have a small effect on the coded protein? (Again, only the first 15 bases of the DNA strand are shown, even though they continue on. HINT: To solve this, you might write out the template DNA strand, the mRNA strand that would be made, and the resulting amino acids for the start of the protein.) Mutation #1: 5-ATGAAAGCCCGGGTT(...)-3' Mutation #2: 5-ATGAACCCCGGGTTT(...)-3' Mutation #3: 5-ATGAACCCGGGTTTA(...)-3' Mutation #4: 5-ATGAAGCCCGGGTTT(...)-3' Mutation #5: 5-ATGTAACCCGGGTTT(...)-3'arrow_forwardThe melting temperature Tm of DNA can be predicted by calculation without actually measuring it. Calculate the Tm of the DNA double strand shown in (1) to (3), and discuss the results. The numbers in parentheses indicate the degree of polymerization of nucleotides.(1) A(10) + T(10), (2) A(15) + T(15), (3) G(10) + C(10)arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license