Biochemistry: Concepts and Connections (2nd Edition)
2nd Edition
ISBN: 9780134641621
Author: Dean R. Appling, Spencer J. Anthony-Cahill, Christopher K. Mathews
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 4, Problem 9P
Suppose that you centrifuged a transfer RNA molecule to equilibrium in an alkaline CsCl gradient, as described in Problem 7. What result would you expect?
7. For some DNAs, it is possible to separate the two strands, after denaturation, in a CsCl gradient.
a. What property of any DNA determines where it will band in a CsCl?
b. What kind of DNA might have two strands that differ sufficiently in this property that they could be separated after denaturation?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
For some DNAS it is possible to separate the two strands, after denaturation,
in a CsCl gradient.
(a) What property of any DNA determines where it will band in a CsCI
gradient?
(b) What kind of DNA might have two strands that differ sufficiently in this
property that they could be separated after denaturation?
For some DNAs, it is possible to separate the two strands, after denaturation,in a CsCl gradient.(a) What property of any DNA determines where it will band in a CsClgradient?(b) What kind of DNA might have two strands that differ sufficiently in thisproperty that they could be separated after denaturation?
snip
Chapter 4 Solutions
Biochemistry: Concepts and Connections (2nd Edition)
Ch. 4 - Prob. 1PCh. 4 - What is the difference between a nucleoside...Ch. 4 - pppApCpCpupApGpApu-OH a. Using the straight-chain...Ch. 4 - Shown is a representation of a molecule being...Ch. 4 - Base analysis of DNA from maize (com) shows it to...Ch. 4 - Using the pKa data in Table 4.1 and the...Ch. 4 - For some DNAs, it is possible to separate the two...Ch. 4 - Refer to Figure 4.15, which presents the...Ch. 4 - Suppose that you centrifuged a transfer RNA...Ch. 4 - Predict the structure of a cruciform that could be...
Ch. 4 - DNA from a newly discovered virus was purified,...Ch. 4 - Would you expect Neurospora crassa DNA to have a...Ch. 4 - A circular double-stranded DNA molecule contains...Ch. 4 - The gel electrophoresis pattern in Figure 4.23 was...Ch. 4 - 15. DNA polymerase requires both a template, to be...Ch. 4 - Prob. 16PCh. 4 - Prob. 17PCh. 4 - a. What two enthalpic factors stabilize DNA in...Ch. 4 - 19.
a. The plasmid pBR322 (4362 base pairs) was...Ch. 4 - Prob. 20PCh. 4 - What DNA sequence feature is required for a...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Consider the following DNA strand with the following nucleotide sequence: 3’-ATATCAGAGAATATCA-5’ The nucleotide sequence of the complementary DNA strand is . b. The nucleotide sequence of the antisense strand used in the transcription process is . c. The nucleotide sequence of the mRNA strand produced after the transcription process is 2. Compute for the base composition of a DNA molecule given that %T is 23% (reported to the nearest whole number; no need to add the % symbol). % A? %C? %G?arrow_forward29.) equalities now called Chargaff's rule. Biochemist Erwin Chargaff was the first to note that, in DNA, [A]=[T] and [G]=[C], A) Using this rule, determine the percentages of all the bases in DNA that is 20% thymine. [A] = [C] = [G] [T] = 20% %3D - B) If a single strand of RNA is 20% uracil, what can you predict about the percentages of the remaining bases and why?arrow_forwardThe melting temperature Tm of DNA can be predicted by calculation without actually measuring it. Calculate the Tm of the DNA double strand shown in (1) to (3), and discuss the results. The numbers in parentheses indicate the degree of polymerization of nucleotides.(1) A(10) + T(10), (2) A(15) + T(15), (3) G(10) + C(10)arrow_forward
- Suppose the following base sequence was found in a 20-base DNA polymer. 3'CAGTTACGGCTCCTAGGTTATAATTCGTTTC 5' a. What would be the first 5 bases at the 3' end of the complementary strand? b. What would be the first 10 bases at the 5' end of the complementary strand? c. Assuming the presence of the complementary strand, what is the percentage composition of the polymer with respect to the A-T base pair? with respect to the G-C base pair? d. In the given segment in problem 1, illustrate and indicate the direction of the synthesis of: i. a 5-nucleotide RNA primer ii. a 5-nucleotide Okazaki fragmentarrow_forwardAssume that a poly(A) tract five base pairs long produces a 20° bend in aDNA strand. Calculate the total (net) bend produced in a DNA if the center base pairs (the third of five) of two successive (dA)5 tracts are located (a) 10 base pairs apart; (b) 15 base pairs apart. Assume 10 base pairs per turn in the DNA double helixarrow_forwardThe High Mobility Group (HMG) proteins are architectural regulators of DNA. Many HMG proteins are phosphorylated at certain serine residues. How would phosphorylation change the binding affinity of HMG proteins to DNA?arrow_forward
- a) It is known that double stranded DNA is denatured at low pH. pKa values should allow the determination of whether this is due to perturbation of the hydrogen bonding in A-T and/or G-C base pairs. The table gives values for the pKas of different protonated groups in the nucleobases.Nucleobase Position & pKa A N1, 3.5 G N7, 1.6; N1, 9.2 C N3, 4.2 T N3, 9.7a) Draw the A-T and G-C base pairs. - Label the bases with the one-letter code. – - Number the atoms in the rings and label the atom that attaches to the sugar. - Mark the groups that interact in normal…arrow_forwardWhere do you predict the N- and C-termini are located for Max? Match the words in the left column to the appropriate blanks in the sentences on the right. electrostatic dispersion negative C-terminus positive positively negatively N-terminus The Reset Help is interacting with the DNA. The first reason for this is because the a-amino group is positively charged and will interact favorably with the of the charge on the phosphodiester backbone of the DNA. The second reason is that this orientation also situates the partial end of the helical macrodipole for favorable interactions with the charged phosphodiester backbone of the DNAarrow_forward"Five prime to three prime" description of a DNA strand refers to: A. the phosphodiester backbone of DNA. B. the phosphorylated 5' carbon at one end, the 3' at the other end. C. the phosphorylated 5' carbon on one sugar and the 3' carbon on the next sugar. D. the location of the hydroxyl groups. KM of a Michaelis–Menten is proportional to: A. The concentration of the ES complex B. The concentration of the substrate C. Both A and B D. Neither A nor Barrow_forward
- Cisplatin preferentially binds N? of the purines adenine and guanine. Draw the product of the following reaction: 3. 2+ `NH H3N. H20 `NH2 ? H3N `H2O 4. Draw the structure of transplatin and discuss its possible interaction with DNA.arrow_forward. The following data represent the base compositions of double-stranded DNA from two different bacterial species and their RNA products obtained in experiments conducted in vitro:a. From these data, determine whether the RNA of these species is copied from a single strand or from both strands of the DNA. Draw a diagram to show how you solve this problem. b. How can you tell if the RNA itself is single stranded or double stranded?arrow_forwardYou're purifying some plasmid DNA from a culture of bacteria and you want to know how pure it is. You measure the optical density at 260 nm and 280 nm and find the ratio is 2.0. You suspect there is RNA contamination in your preparation, so you treat your preparation with RNase. But the ratio is still 2.0. Protein assays tell you there is no protein in your solution, and no other biological molecules absorb light very efficiently at those wavelengths. What's the explanation?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
BiochemistryBiochemistryISBN:9781319114671Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.Publisher:W. H. Freeman
Lehninger Principles of BiochemistryBiochemistryISBN:9781464126116Author:David L. Nelson, Michael M. CoxPublisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...BiochemistryISBN:9781118918401Author:Donald Voet, Judith G. Voet, Charlotte W. PrattPublisher:WILEY
BiochemistryBiochemistryISBN:9781305961135Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougalPublisher:Cengage Learning
BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...BiochemistryISBN:9780134015187Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. PetersonPublisher:PEARSON
Biochemistry
Biochemistry
ISBN:9781319114671
Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher:W. H. Freeman
Lehninger Principles of Biochemistry
Biochemistry
ISBN:9781464126116
Author:David L. Nelson, Michael M. Cox
Publisher:W. H. Freeman
Fundamentals of Biochemistry: Life at the Molecul...
Biochemistry
ISBN:9781118918401
Author:Donald Voet, Judith G. Voet, Charlotte W. Pratt
Publisher:WILEY
Biochemistry
Biochemistry
ISBN:9781305961135
Author:Mary K. Campbell, Shawn O. Farrell, Owen M. McDougal
Publisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
Fundamentals of General, Organic, and Biological ...
Biochemistry
ISBN:9780134015187
Author:John E. McMurry, David S. Ballantine, Carl A. Hoeger, Virginia E. Peterson
Publisher:PEARSON
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license