Biochemistry
9th Edition
ISBN: 9781319114671
Author: Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.
Publisher: W. H. Freeman
expand_more
expand_more
format_list_bulleted
Concept explainers
Question
Chapter 31, Problem 23P
Interpretation Introduction
Interpretation:
The peptide sequence of the given mRNA sequence should be determined.
Concept introduction:
tRNA (transfer ribonucleic acid) is a type of RNA, which decodes mRNA into a protein sequence. During the process of translation, tRNAs bind to specific sites on the ribosome. For each codon on mRNA, there is an anticodon on tRNA. Binding of these two RNAs helps in the proper synthesis of proteins.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
AAAGAGAAAAGAAUA
to AAAGAGAAAUGAAUA.
Suppose the codon sequence
has a single base pair mutation
If the old protein sequence was Lys-Glu-Lys-Arg-Ile, what will be the new sequence encoded by the mutant gene?
(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Leu-Pro.)
Submit Answer
Retry Entire Group No more group attempts remain
An extra piece. In one type of mutation leading to a form of
thalassemia, the mutation of a single base (G to A) generates a new 3'
3' splice site (blue in the illustration below) akin to the normal one
(yellow) but farther upstream.
Normal 3' end
of intron
5' CCTATTGGTCTATTITCCACCCITAGGCTGCTG 3'
5' CCTATTAGTCTAIIIICCACCCTTAGGCTGCTG 3'
What is the amino acid sequence of the extra segment of protein
synthesized in a thalassemic patient having a mutation leading to
aberrant splicing? The reading frame after the splice site begins with
TCT.
Transcription. Using strand 1 of the DNA molecule as a template, transcribe a messenger RNA molecule (a.k.a. mRNA transcript).
Strand 1
3’ End
TTG
CTT
CAC
CTT
GCG
CGC
CCG
CGC
TAA
TTG
5’ end
mRNA
Chapter 31 Solutions
Biochemistry
Ch. 31 - Prob. 1PCh. 31 - Prob. 2PCh. 31 - Prob. 3PCh. 31 - Prob. 4PCh. 31 - Prob. 5PCh. 31 - Prob. 6PCh. 31 - Prob. 7PCh. 31 - Prob. 8PCh. 31 - Prob. 9PCh. 31 - Prob. 10P
Ch. 31 - Prob. 11PCh. 31 - Prob. 12PCh. 31 - Prob. 13PCh. 31 - Prob. 14PCh. 31 - Prob. 15PCh. 31 - Prob. 16PCh. 31 - Prob. 17PCh. 31 - Prob. 18PCh. 31 - Prob. 19PCh. 31 - Prob. 20PCh. 31 - Prob. 21PCh. 31 - Prob. 22PCh. 31 - Prob. 23PCh. 31 - Prob. 24PCh. 31 - Prob. 25PCh. 31 - Prob. 26PCh. 31 - Prob. 27PCh. 31 - Prob. 28PCh. 31 - Prob. 29PCh. 31 - Prob. 30PCh. 31 - Prob. 31PCh. 31 - Prob. 32PCh. 31 - Prob. 33PCh. 31 - Prob. 34PCh. 31 - Prob. 35PCh. 31 - Prob. 36PCh. 31 - Prob. 37PCh. 31 - Prob. 38PCh. 31 - Prob. 39PCh. 31 - Prob. 40PCh. 31 - Prob. 41PCh. 31 - Prob. 42PCh. 31 - Prob. 43PCh. 31 - Prob. 44PCh. 31 - Prob. 45PCh. 31 - Prob. 46PCh. 31 - Prob. 47PCh. 31 - Prob. 48PCh. 31 - Prob. 49PCh. 31 - Prob. 50PCh. 31 - Prob. 51PCh. 31 - Prob. 52P
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.Similar questions
- Question 8 Review translation. Match the term and its description. Each term can only be used once. This site holds the tRNA that carries the growing polypeptide chain | Choose ) This site holds the tRNA that carries the next amino acid to be | Choose J added to the chain This site is the exit site, where discharged tRNAS leave the [ Choose ) ribosome Initiation, elongation and termination | Choose J >arrow_forwardBe sure to answer all parts. Write a possible mRNA sequence that codes for each peptide. a. His-Cys-Tyr-Val-Ser 5¹- b. Phe-Val-Thr-Tyr-Glu 5'- 5'- c. Trp-Phe-Asn-Gln -3' U -3' с Table 26.2 The Genetic Code-Triplets in Messenger RNA First Base (5' end) -3' U UUU UUC UUA UUG CUU CUC CUA CUG AUL Phe Phe Leu Leu Leu Leu Leu Leu la C UCU UCC UCA UCG CCU CCC CCA CCG Second Base A UAU UAC UAA UAG CAU CAC CAA CAG Ser Ser Ser Ser Pro Pro Pro Pro Tyr 55 Tyr Stop Stop His His Gin Gin G UGU UGC UGA UGG CGU CGC CGA CGG Cys Cys Stop Trp Arg Arg Arg Arg Third Base (3¹ ond) DUAC DU AG с А Аarrow_forwardOriginal sequence: Consider the following coding 71 nucleotide DNA template sequence (It does not contain a translational start): 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3’ Question: 4) In a mutant you discovered that the underlined nucleotide has been deleted. What would the resulting peptide sequence be? What type of mutation is this? 5’-GTTTCCCCTATGCTTCATCACGAGGGCACTGACATGTGTAAACGAAATTCCAACCTGAGCGGCGT GTTGAG-3arrow_forward
- Complements. The sequence of part of an mRNA is 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' 5'-AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG-3' What is the sequence of the DNA coding strand? Of the DNA template strand?arrow_forwardLeaderless. The MRNA for the A repressor begins with 5'-AUG-3', 5'-AUG-3', which encodes the methionine residue that begins the protein. What is unusual about this beginning? Would it cause the MRNA to translate efficiently or not?arrow_forwardMultiple choice A. The role of tRNA in translation is to be translated by a ribosome. incorporate into a polypeptide chain. attach amino acids to a polypeptide chain. carry amino acids to the ribosome. Multiple choice B. Translation continues until the ribosome falls off the end of the RNA. the ribosome encounters a transcriptional termination site. the ribosome encounters a stop codon. the ribosome falls off the DNA.arrow_forward
- MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.arrow_forwardInitiation. Bacterial protein synthesis is initiated by: a. S-adenosylmethionyl tRNA b. Methionyl TRNA c. N-formylmethionyl tRNA d. N10-formyltetrahydrofolateN"-formyltetrahydrofolate †RNA „N10arrow_forwardOpen reading frames... correspond to introns, which are not read by the ribosome during translation correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in a particular frame correspond to contiguous fragments of DNA sequence that do not contain a stop codon when read in any of six frames are often rich in acetylated histones which allow transcription occur when fragments of DNA sequence are highly similar between two species are recognized by ribosomes to initiate translationarrow_forward
- Hi, help please. Which of the following is TRUE regarding RNA editing? a .The coding sequence is altered in the chromosome b. More than one answer choice is correct c. The mRNA is altered by Guide RNAs d. Translation first takes place, following by altering of the coding sequencearrow_forwardDescribe translation. What is the function of the aminoacyl-tRNA synthase?arrow_forwardA cluster of ribosomes. In a polysome, or polyribosome, the polypeptides associated with which ribosomes will be the longest: a. They will be the same length since the rate of translation is constant. b. Those at the 3'-end3'-end of the mRNA. c. Those at the 5'-end5'-end of the MRNA. d. Those in the middle of the mRNA.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- BiochemistryBiochemistryISBN:9781305577206Author:Reginald H. Garrett, Charles M. GrishamPublisher:Cengage Learning
Biochemistry
Biochemistry
ISBN:9781305577206
Author:Reginald H. Garrett, Charles M. Grisham
Publisher:Cengage Learning
DNA vs RNA (Updated); Author: Amoeba Sisters;https://www.youtube.com/watch?v=JQByjprj_mA;License: Standard youtube license