Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 33P
Recall that Leber congenital amaurosis (LCA), a form of congenital blindness in humans, can be caused by homozygosity for recessive mutations in the RPE65 gene. Recently, a rare dominant mutation in RPE65 has been implicated as one cause of an eye disease called retinitis pigmentosa, which is characterized by retinal degeneration that can progress to blindness. The dominant RPE65 mutation is a missense mutation causing amino acid 447 in the polypeptide to change from Asp to Glu. Little is known about the nature of the mutant protein.
| a. | Do you think that the dominant allele is more likely a loss-of-function or a gain-of-function mutation? Explain. |
| b. | As described in this chapter, gene therapy for LCA has been at least partially successful. Do you think that the same kind of gene therapy can be used for patients with retinitis pigmentosa caused by the dominant mutant allele of RPE65? Explain. |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Leber congenital amaurosis (LCA) is a form of congenital blindness in humans and is known to be caused by homozygosity for recessive mutations in the RPE65 gene. Recently, a rare dominant mutation in RPE65 has been implicated as one cause of an eye disease called retinitis pigmentosa, which is characterized by retinal degeneration that can progress to blindness. The dominant RPE65 mutation is a missense mutation causing amino acid 447 in the polypeptide to change from Asp to Glu. Little is known about the nature of the mutant protein.
a. Do you think that the dominant allele is more likely a loss-of-function or a gain-of-function mutation? Explain.
b. Recently a group of clinicians and scientists reported that gene therapy (gene replacement therapy) for LCA has been at least partially successful. Do you think that the same kind of gene therapy can be used for patients with retinitis pigmentosa caused by the dominant mutant allele of RPE65? Explain.
Based on standard MS- LS3-1:
Fish in a cave system in Mexico is missing its eyes, has thin, translucent skin, and is relatively small (7-10 cm in length).
Can you describe by model why structural changes to genes (mutations) on chromosomes may affect proteins and may result in beneficial effects to the structure and function of the fish?
Can you answer in the following format?
1-
Structure
How Structure and Function is Affected by Mutations in Blind Fish
Eyes
Scales
Taste Cells
Lateral Line
2- Model to explain what causes these changes:
Change: ______________ Adapting an Organism to the Dark
Cause: ________________ Stop the Growth of Eyes
Effect: ___________________ Fish with Heightened Other Senses
References:
Video: Rare Blind Cave Fish in Mexican Cave System
https://www.youtube.com/watch?v=MWdtGuDd8z0
Fact Sheet: Blind Cave Fish
https://www.denverzoo.org/animals/blind-cave-fish
Information: Mexican Tetra…
Leber Congenital Amaurosis (LCA) causes progressive vision loss due to defects in the gene that encodes RPE65 isomerase. Affected individuals are homozygous recessive for mutant alleles of the RPE65 gene. You are trying to determine the molecular nature of the mutations in three individuals with LCA. For ease of analysis, you may assume that each individual is homozygous for the same mutant allele (though the three individuals have different mutations than each other). You use the polymerase chain reaction to amplify DNA from each patient and you determine the sequence of the DNA and compare it to unaffected individuals. You identify the following differences. Note that the non-template strand of DNA is given and the changes are highlighted using red boldface. You can assume that the sequences are in the first reading frame (eg. the first three nucleotides of each sequence is a codon). The coding region of the gene is 1602 bp and the position of the sequences shown below is…
Chapter 18 Solutions
Genetics: From Genes to Genomes
Ch. 18 - Match each of the terms in the left column to the...Ch. 18 - Mice are usually gray, but a mouse geneticist has...Ch. 18 - Sometimes, genes transferred into the mouse genome...Ch. 18 - In mice, a group of so-called Hox genes encode...Ch. 18 - The fly eyes shown in Fig. 18.7 are malformed...Ch. 18 - This problem concerns a technique called enhancer...Ch. 18 - Fish and other organisms that live in the Arctic...Ch. 18 - a. Describe two ways you could potentially make a...Ch. 18 - Figure 18.6 shows a picture of Glofish ,...Ch. 18 - Some people are concerned about the possible...
Ch. 18 - The goal of the Knockout Mouse Project is to...Ch. 18 - Prob. 12PCh. 18 - Prob. 13PCh. 18 - a. Which genome manipulation technique would you...Ch. 18 - a. Diagram a knockin construct that could have...Ch. 18 - Prob. 16PCh. 18 - Prob. 17PCh. 18 - The transcription factor Pax6 is required...Ch. 18 - Mouse models for human genetic diseases are...Ch. 18 - One way to determine where inside a cell a protein...Ch. 18 - In Problem 5 in Chapter 17, you saw that a SNP...Ch. 18 - Scientists now routinely use CRISPR/Cas9 to make...Ch. 18 - Geneticists are currently considering using...Ch. 18 - a. Figures 18.9 and 18.12 demonstrated methods to...Ch. 18 - Nonhomologous end-joining NHEJ of a double-strand...Ch. 18 - One problem that researchers sometimes encounter...Ch. 18 - Researchers at the University of California at San...Ch. 18 - Prob. 28PCh. 18 - F. Port and S. Bullock at the University of...Ch. 18 - On Fig 18.14, locate the PAM site and identify the...Ch. 18 - Prob. 31PCh. 18 - Prob. 32PCh. 18 - Recall that Leber congenital amaurosis LCA, a form...Ch. 18 - One potential strategy for gene therapy to correct...Ch. 18 - Recently, scientists have used a mouse model for...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- a. Some antibiotics, such as rifampin, interfere with the function of RNA polymerase. What biological process is rifampin disrupting? b. Some antibiotic-resistant M. tuberculosis bacteria have a single point mutation (CàT) in the rpoB gene that causes an amino acid change from serine (a polar amino acid) to leucine (a non-polar amino acid). What type of mutation is this? Do you expect this to have no effect, a small effect, or a large effect on the polypeptide produced? Explain your reasoning. c. The rpoB gene encodes a subunit of the bacterial RNA polymerase protein. The point mutation described in Question 2 causes a change in protein folding, which leads to the inability of the rifampin antibiotic to bind to the RNA polymerase. Which level(s) of protein structure is/are affected by this change?arrow_forwardA 19 year old female patient is diagnosed with chronic myelogenous leukemia. Karyotype analysis shows that the leukemic cells of this patient are heterozygous for a reciprocal translocation involving chromosomes 9 and 22. However, none of the normal, nonleukemic cells of this patient contain the translocation. a) Describe a molecular test to determine if chemotherapy given to the patient described would be completely succesful. (That is, devise a method to make sure that the patient's blood would be free of leukemic cells.) Be as specific as possible.arrow_forwardA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionarrow_forward
- The following is a list of mutational changes. For eachof the specific mutations described, indicate which ofthe terms in the right-hand column applies, either as adescription of the mutation or as a possible cause.More than one term from the right column can applyto each statement in the left column.1. an A–T base pair in the wild-type gene ischanged to a G–C pair2. an A–T base pair is changed to a T–A pair3. the sequence AAGCTTATCG is changed toAAGCTATCG4. the sequence CAGCAGCAGCAGCAGCAGis changed toCAGCAGCAGCAGCAGCAGCAGCAG5. the sequence AACGTTATCG is changed toAATGTTATCG6. the sequence AACGTCACACACACATCGis changed to AACGTCACATCG7. the sequence AAGCTTATCG is changed toAAGCTTTATCGa. transitionb. basesubstitutionc. transversiond. deletione. insertionf. deaminationg. X-rayirradiationh. intercalatori. slippedmispairingarrow_forwardIn a disorder called gyrate atrophy, cells in the retina begin to degenerate in late adolescence, causing night blindness that progresses to total blindness. The cause is a mutation in the gene that encodes an enzyme, ornithine aminotransferase (OAT). Researchers sequenced the OAT gene for 5 patients with the following results: Patient A: A change in codon 209 of UAU to UAA Patient B: A change in codon 299 of UAC to UAG Patient C: A change in codon 426 of CGA to UGA Patient D: A two-nucleotide deletion at codons 64 and 65 that results in a UGA codon at position 79. Patient E: Exon 6, including 1071 nucleotides is entirely deleted. Which patient(s) have a frameshift mutation? How many amino acids is patient E missing? Which patient(s) will produce a shortened protein?arrow_forward1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Please EXCLUDE the use of CRISPR from consideration. A. Will you use germline or somatic cell gene therapy? Please NAME and DEFINE the form of gene therapy selected, then explain WHY this is the most appropriate choice.arrow_forward
- 1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). a) Hypothetically, what specific type of VECTOR will you use to perform your gene therapy? Please select from the following list of potential vectors: disabled retrovirus, adenovirus, adeno-associated virus (AAV), or herpes simplex virus (HSV), then give two reasons why this specific vector is the most appropriate for your gene therapy. Please explain why you were able to rule out the other potential…arrow_forward1). In the absence of this enzyme, a substance called ceroid lipofuscin accumulates in lysosomes in the brain, resulting in seizures, blindness, decline in cognitive function and motor skills, dementia, and death by the late teens or early 20’s. The TPP1 gene is 6695 bp in length. Think about the characteristics of Batten disease, and then suggest an approach to gene therapy that might be effective for this specific genetic disorder. You may assume that your research team is working in the U.S. and your research is funded by a grant from the National Institutes of Health (NIH). Other scientists have suggested that it might be possible to use CRISPR to treat this genetic disorder in affected individuals. (i) First, what is CRISPR? (BRIEFLY describe what it is and how it works). (ii) Briefly describe how CRISPR could be utilized in treating genetic conditions such as Batten disease.arrow_forwardMutations within the genes for ARSs, are known to be cause certain human maladies, such as the neurodegenerative disorder Charcot-Marie-Tooth (CMT) disease along with other central nervous system dysfunctions, and cancer. Interestingly, not all those who possess mutations within specific ARS genes do not display the disease phenotype. Provide at least one reason why a person might survive. Remember, do not just name a concept. Describe the concept and then explain WHY (on a molecular level) this explanation holds true.arrow_forward
- Cx is a member of the family of connexin genes that encode the proteins of gap junction intercellular channels. Cx proteins in one cell form hemi-channels in the plasma membrane. Hemi-channels in adjacent cells dock to form complete intercellular channels through which ions and small molecules diffuse from cell to cell. Distinct Cx mutations were identified in three different families, F1, F2 and F3, affected by the same disease. To study their functional properties, normal (wild type, wt) and mutant (m) Cx proteins were expressed in cultured cells. Translation of the proteins was checked (Fig. 3). A extracellular EC 1 SM TM 1 membrane 2 3 4 F10 intracellular N F2 EC 2 F3 oricand c B 42 kDa C 42 kDa 35 kDa Control wt m-F1 m-F2 PM C PM C PM C PM C Western blot anti-Cx Control wt PM C m-F1 PM C PM C = Metabolically labelled m-F2 PM C m-F3 PM C m-F3 PM C WSEY Fig. 3 mont (A). Membrane topology of Cx protein indicating positions of mutations. Cx is an integral membrane protein with 4…arrow_forwardAn individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon. Prior to acquiring this mutation,the individual had been exposed to UV light, proflavin, and5-bromouracil. Which of these three agents would be the mostlikely to have caused this somatic mutation? Explain your answer.arrow_forwardWhat is the underlying genetic defect that causes xeroderma pigmentosum?How can the symptoms of this disease be explained by the genetic defect?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Mitochondrial mutations; Author: Useful Genetics;https://www.youtube.com/watch?v=GvgXe-3RJeU;License: CC-BY