Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 18, Problem 25P
Nonhomologous end-joining (NHEJ) of a double-strand break almost always results in perfect resealing of the DNA lesion, without the loss or gain of
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
The following illustrates a jagged double-strand DNA break resulting from Cas9 cleavage that
occurred in the first step of genome editing using CRISPR-Cas9 technology:
5'-GCGCCGTCC
3'-CGCGGC
CTGTCAGGCGACACT-3'
AGGGACAGTCCGCTGTGA-5'
Which of the double-stranded DNA sequences listed below (A-D) is expected to result from repair of
the break above via non-homologous end joining? Note: this question is not asking what kinds of
mutations result from NHEJ repair of Cas9 cleavage in general, but specifically what is expected to
result from repair of the jagged cut illustrated above? In the answer choices below, sequences that
are the same in all four options are shown in bold to help you spot the differences.
A. 5'-GCGCCGCTGTCAGGCGACACT-3'
3'-CGCGGCGACAGTCCGCTGTGA-5'
B. 5'-GCGCCGTCTGTCAGGCGACACT-3
3'-CGCGGCAGACAGTCCGCTGTGA-5'
C. 5'-GCGCCGTCCCTGTCAGGCGACACT-3'
3'-CGCGGCAGGGACAGTCCGCTGTGA-5'
D. 5'-GCGCCGAGACTGTCAGGCGACACT-3'
3'-CGCGGCTCTGACAGTCCGCTGTGA-5'
Prior to the publication of the article from which this assay comes from (picture), the Cas9 endonuclease was known to be involved in CRISPR RNA (crRNA) maturation, but the mechanism by which Cas9 participates in targeted DNA disruption was unknown. To test whether and how Cas9 might be able to target DNA cleavage, researchers developed an in vitro assay. One of the first steps was to purify the Cas9 protein from Streptococcus pyogenes and several orthologs. The description of the figure states: SDS-PAGE analysis of purified Cas9 orthologs. Cas9 orthologs were purified as described in Supplementary Materials and Methods. 2.5 ug of each purified Cas9 were analyzed on a 4-20% gradient polyacrylamide gel and stained with SimplyBlue Safe Stain. Answer the following questions based on this information and the figure.
a. What is the experimental/research question and state a hypothesis related to this question.
b. What is the approach of the figure and provide a description of techniques…
When a genome is edited using the CRISPR/Cas9 system, a knockout allele can be produced if DNA is repaired by ["homologous recombination", "base excision repair", "nucleotideexcision repair", "nonhomologous end joining"] , and a knockin allele will result if DNA is repaired by ["base excision repair", "homologous recombination", "nonhomologous end joining", "nucleotide excision repair"] . Pick the correct answers within the quotation marks to fill in the blank.
Chapter 18 Solutions
Genetics: From Genes to Genomes
Ch. 18 - Match each of the terms in the left column to the...Ch. 18 - Mice are usually gray, but a mouse geneticist has...Ch. 18 - Sometimes, genes transferred into the mouse genome...Ch. 18 - In mice, a group of so-called Hox genes encode...Ch. 18 - The fly eyes shown in Fig. 18.7 are malformed...Ch. 18 - This problem concerns a technique called enhancer...Ch. 18 - Fish and other organisms that live in the Arctic...Ch. 18 - a. Describe two ways you could potentially make a...Ch. 18 - Figure 18.6 shows a picture of Glofish ,...Ch. 18 - Some people are concerned about the possible...
Ch. 18 - The goal of the Knockout Mouse Project is to...Ch. 18 - Prob. 12PCh. 18 - Prob. 13PCh. 18 - a. Which genome manipulation technique would you...Ch. 18 - a. Diagram a knockin construct that could have...Ch. 18 - Prob. 16PCh. 18 - Prob. 17PCh. 18 - The transcription factor Pax6 is required...Ch. 18 - Mouse models for human genetic diseases are...Ch. 18 - One way to determine where inside a cell a protein...Ch. 18 - In Problem 5 in Chapter 17, you saw that a SNP...Ch. 18 - Scientists now routinely use CRISPR/Cas9 to make...Ch. 18 - Geneticists are currently considering using...Ch. 18 - a. Figures 18.9 and 18.12 demonstrated methods to...Ch. 18 - Nonhomologous end-joining NHEJ of a double-strand...Ch. 18 - One problem that researchers sometimes encounter...Ch. 18 - Researchers at the University of California at San...Ch. 18 - Prob. 28PCh. 18 - F. Port and S. Bullock at the University of...Ch. 18 - On Fig 18.14, locate the PAM site and identify the...Ch. 18 - Prob. 31PCh. 18 - Prob. 32PCh. 18 - Recall that Leber congenital amaurosis LCA, a form...Ch. 18 - One potential strategy for gene therapy to correct...Ch. 18 - Recently, scientists have used a mouse model for...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Which of the delivery techniques mentioned in Table 2 can be used to best transfer recombinant plasmids into E. coli cellsarrow_forwardNow that you understand how the CRISPR-Cas9 system works, think back to the experiments discussed in the introduction to this chapter, in which researchers used CRISPR-Cas9 genome editing to treat mice with Duchenne muscular dystrophy. Why did the researchers choose to cut out the entire exon 23 in the mice with the disorder? Why not replace the specific mutation using a donor piece of DNA and homologous recombination? Propose some possible explanations.arrow_forwardWhat is the difference between nonhomologous end-joining (NHEJ) and homology-directed repair (HDR) in the context of genome editing?arrow_forward
- With reference to the image below, discuss the process and principle involved for screening/selection of hosts (last stage of cloning) containing the intended recombinant plasmid. LacZ' = Gene for alpha-peptide of β-galactosidase.arrow_forwardPrior to the publication of the article from which this assay comes from (picture), the Cas9 endonuclease was known to be involved in CRISP RNA (crRNA) maturation, but the mechanism by which Cas9 participates in targeted DNA disruption was unknown. To test whether and how Cas9 might be able to target DNA cleavage, researchers developed an in vitro assay. One of the first steps was to purify the Cas9 protein from Streptococcus pyogenes and several orthologs. The description of the figure states: SDS-PAGE analysis of purified Cas9 orthologs. Cas9 orthologs were purified as described in Supplementary Materials and Methods. 2.5 ug of each purified Cas9 were analyzed on a 4-20% gradient polyacrylamide gel and stained with SimplyBlue Safe Stain. Answer the following questions based on this information and the figure. a. Results: Explain the data in terms of observations and patterns. b. Conclusion: Describe how the data support or not support the hypothesis. c. Briefly describe a next…arrow_forwardTo test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a nasal swab to a double-stranded DNA copy (dsDNA). If the virus is present, its genomic sequence should be in some of the new dsDNA molecules. Part 1) A region of COVID genomic DNA sequence is shown below. Following convention, only the top strand is shown. Copy/paste the sequence into the text box and create the second strand. Be sure to label its ends. (You may need to reduce the font size so that it doesn't wrap around) AAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACAACTTCCTC Part 2) To test for the presence of COVID DNA sequence, lab workers use single-stranded DNA oligonucleotides as probes (short pieces of DNA that do not have a partner strand). If the two strands of DNA that you drew were separated from each other, where would the shorter DNA strand shown below be able to form continuous base pairs? Highlight that region in your dsDNA model. TGTAGCACGATTGCAGCATTG Note: If you…arrow_forward
- How can the genetic defect phenylketonuria (PKU), which is caused by mutations in the phenylalanine hydroxylase (PAH) gene be corrected by using the CRISPR/Cas9 system and homology directed DNA repair.arrow_forwardIn a clinical context, a scientist is working with a viral DNA which is about 24000bps long. There are two known variants of the virus that share almost the same DNA but for a final fragment; with reference to Figure Q2b, the regions A and B are conserved in both variants, while the region C differs and is either 320bps (variant 1) or 380bps (variant 2). The scientist wants to set up a procedure to identify the variant they are dealing with. Viral dsDNA (i) (ii) (iii) Stable region (A) Variable region (C) Figure Q2b Known sequence (B) 5-GACCTCAATGTCCAGCGGTACGCTCATAAA-3' 3'-CTGGAGTTACAGGTCGCCATGCGAGTATTT-5' The scientists want to design a primer to amplify the variable region and to do so, they sequence a small fragment (sequence B) the conserved region close to the variable region C. Why is the scientist targeting a region outside of the fragment of interest? [3] The sequence of the fragment B is reported in Figure Q2b. Suggest a primer that can efficiently target this region and…arrow_forwardExtreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response function? Answer choices induction of photolyase and the addition of white light to remove the thymine dimer destruction of lexA, which leads to expression of an alternate, error-prone DNA polymerase homologous recombination repair non-homologous end joining exinuclease removal of a segment of DNA including a thymine dimer, followed by the replacement of DNA using the complementary strand of DNAarrow_forward
- Many resistance mechanisms are encoded on plasmids. These mechanisms are of great clinical significance, because they can spread very easily through horizontal gene transfer. A culture of the bacterial isolate is grown, and plasmid DNA is isolated using a spin column-based solid phase extraction method. The purified plasmid DNA is then submitted for next-generation sequencing. Bioinformatic analyses of the sequencing results suggests that the following gene is likely involved in antibiotic resistance: > putative antibiotic resistance gene ATGCGTGTATTAGCCTTATCGGCTGTGTTTTTGGTGGCATCGATT ATCGGAATGCCTGCGGTAGCAAAGGAATGGCAAGAAAACAAAAGT TGGAATGCTCACTTTACTGAACATAAATCACAGGGCGTAGTTGTG CTCTGGAATGAGAATAAGCAGCAAGGATTTACCAATAATCTTAAA CGGGCGAACCAAGCATTTTTACCCGCATCTAGTGCGAAAATTCCC AATAGCTTGATCGCCCTCGATTTGGGCGTGGTTAAGGATGAACAC CAAGTCTTTAAGTGGGATGGACAGACGCGCGATATCGCCACTTGG AATCGCGATCATAATCTAATCACCGCGATGAAATATTCAGTTGTG CCTGTTTATCAAGAATTTGCCCGCCAAATTGGCGAGGCACGTATG…arrow_forwardUsing the plasmid map of pBCH2.0 provided above, predict how many DNA fragments would be formed if this plasmid was digested with restriction enzyme BamHI.arrow_forwardRestriction endonucleases are bacterial enzymes that cleave duplex (double-stranded) DNA at specific nucleotide sequences. The mode of replication of the animal virus SV40 has been investigated by using restriction endonucleases that cleave SV40 DNA into a number of unique segments. Like most viruses, SV40 DNA is circular. The map positions of the 11 fragments produced by a pair of restriction endonucleases are shown on the next page. Immediately following a 5 or 10 minute pulse of radioactively labeled thymidine, labeled SV40 molecules that have completed replication during the pulse are isolated. These newly replicated DNA molecules are digested by the restriction endonucleases and the resulting fragments are analyzed for the relative amounts of pulse label they contain. The results are in the table below. Assume that at the time the label was added there was a random population of replicating SV40 DNA molecules in all possible stages of synthesis. From the information given below,…arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Molecular Techniques: Basic Concepts; Author: Dr. A's Clinical Lab Videos;https://www.youtube.com/watch?v=7HFHZy8h6z0;License: Standard Youtube License