Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 17.1, Problem 1MI
Examine the uncut piece of DNA shown in the upper half of this figure. Where would an exonuclease cleave?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand.
Sequence to be amplified:
5’- GGTATTGGCTACTTACTGGCATCG- 3’
3’- CCATAACCGATGAATGACCGTAGC- 5’
Primers: 5’-TGGC-3’ and 5’-TGCC-3’
This is part of the Escherichia coli DNA sequence that contains an inverted repeat.
(Note: top strand is the coding strand).
5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3'
3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5'
(i)
Draw the structure of hairpin loop that will be formed during the end of transcription.
(ii) Describe the function of the hairpin loop during transcription.
Name the enzymes that cut the DNA at specific sequences and create sticky ends.
Chapter 17 Solutions
Prescott's Microbiology
Ch. 17.1 - Examine the uncut piece of DNA shown in the upper...Ch. 17.1 - Which of the above enzymes yield blunt ends? Which...Ch. 17.1 - Prob. 3MICh. 17.1 - What would you conclude if you obtained only blue...Ch. 17.1 - Why must introns be removed from eukaryotic DNA...Ch. 17.1 - Which plasmid is a shuttle vector? Why?Ch. 17.1 - In what ways does the BAC shown here differ from...Ch. 17.1 - Describe restriction enzymes, sticky ends, and...Ch. 17.1 - What is cDNA? Why is it necessary to generate cDNA...Ch. 17.1 - Prob. 3CC
Ch. 17.1 - Prob. 4CCCh. 17.1 - Prob. 5CCCh. 17.2 - Why, after three cycles, are the vast majority of...Ch. 17.2 - Briefly describe the polymerase chain reaction....Ch. 17.2 - Why is PCR used to detect infectious agents that...Ch. 17.2 - How would you use PCR to measure the concentration...Ch. 17.2 - Why is it possible to visualize a PCR product on...Ch. 17.2 - Prob. 5CCCh. 17.3 - Why are long fragments (e.g., 20,000 bp) of...Ch. 17.4 - What special considerations are necessary if one...Ch. 17.4 - Prob. 1CCCh. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - You are studying chemotaxis proteins in a newly...Ch. 17.5 - Prob. 1MICh. 17.5 - Prob. 1CCCh. 17.5 - Prob. 2CCCh. 17 - Which of the DNA molecules shown are recombinant?Ch. 17 - Prob. 1RCCh. 17 - Prob. 2RCCh. 17 - Prob. 3RCCh. 17 - Prob. 4RCCh. 17 - Prob. 5RCCh. 17 - Prob. 6RCCh. 17 - Prob. 1ALCh. 17 - Prob. 2ALCh. 17 - Suppose you transformed a plasmid vector carrying...Ch. 17 - You are interested in the activity and regulation...Ch. 17 - Prob. 5ALCh. 17 - Prob. 6ALCh. 17 - Prob. 7AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Telomerase is a reverse transcriptase enzyme that carries its own RNA molecule (Figure 1(a)). The telomerase enzyme attaches to the end of the telomeric region (Figure 1(b)) for DNA replication. (i) Indicate by drawing where the RNA of Telomerase binds to the telomeric region. W, X, Y, and Z are the ends of the DNA and RNA strands respectively. Identify ends of DNA's X, Y, and Z shown in Figure 1(a) & (b). (ii) (a) Telomerase -AAUCCCAAU- ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' ПAАTСССААТСССААТСССАА-Х (b) Telomeric DNA Figure 1arrow_forwardA DNA strand was sequenced using the Sanger method (https://www.youtube.com/watch?v=KTstRrDTmWI). The reaction tube contained the DNA strand, fluorescently labelled dideoxynucleotide triphosphates (ddATP – yellow, ddGTP – green, ddCTP – blue, ddTTP - red), deoxynucleotide triphosphates, DNA polymerase, or its Klenow fragment. Synthesis of DNA is allowed to proceed, and the results are shown on the right: 15 14 13 12 11 10 (a) What is the sequence of the copy and the template strands? (b) If the template strand were in the 5'-3' direction, what will be the sequence of the DNA copy? Nucleotide Lengtharrow_forwardReferring to Figure 7-20, answer the following questions:a. What is the DNA polymerase I enzyme doing?b. What other proteins are required for the DNApolymerase III on the left to continue synthesizingDNA?c. What other proteins are required for the DNApolymerase III on the right to continue synthesizingDNA?arrow_forward
- please do only part D .arrow_forwardthe one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?arrow_forwardA). Briefly describe the function of telomerase. B). How does the structure of telomerase allow it to complete the function you described?arrow_forward
- There are 6 parts to this question: This is a follow up to the prior question regarding the replication of the DNA strand below. The DNA strand is here for your reference and you do not need to do anything with or to it. TC GATATCGG AGCTATAGCC c) what enzyme separated the parental DNA template strands, d) what bonds were broken? e) what enzyme replicates DNA f) before DNA can be replicated/copied, what must be laid down to allow the enzyme in "e" to replicated the DNA (be specific)? g) our DNA is replicated in many "pieces", what enzyme connects these many "pieces" into one continuous DNA strand that becomes the sister chromatid? h) during what specific phase of the cell cycle does this DNA replication process occur? (This should be a review question from last topics we covered).arrow_forwardThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: bottom strand is the noncoding strand). 5'-ААCGCATGAGAAAGCCCCCCGGAAGATCACСТТСCGGGGGCТТТАТАТААТТАGC-3' 3'-тTGCGTACтстттCGGGGGGCCTTCTAGTGGAAGGCCCCCGАААТАТАТТААТтCG-5' (i) Draw the structure of hairpin loop that will be formed during transcription. (ii) Illustrate how the hairpin loop structure initiates the termination of transcription.arrow_forwardWhat would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids).arrow_forward
- Given the DNA template strand 3' GCATTCAAG 5', write the amino acid sequence in the N‑terminal to C‑terminal direction. Note: Enter the amino acids using their three-letter designations. Put a hyphen between each amino acid.arrow_forwardChoose one of the strands and transcribe the strand. Show the steps (with proper label) and do a post-transcriptional processing. Once the transcript is made, do the process of translation. Again follow the steps. Use the Wobble Table for reference. DNA strand: 5'-TCGAAACGAGCTGCAGCTAGCTAGCTACGTCAGCTGCATCTGTCTACGAGCGACTGTCTAGCATAGCGTAGCTGC-3 'Complementary strand: 3'-TCGAAACGAGCTGCAGCTAGCTAGCTACGTCAGCTGCATCTGTCTACGAGCGACTGTCTAGCATAGCGTAGCTGC-5'arrow_forwardUse the first picture for to answer the following questions.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY