Prescott's Microbiology
11th Edition
ISBN: 9781260211887
Author: WILLEY, Sandman, Wood
Publisher: McGraw Hill
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17.1, Problem 7MI
In what ways does the BAC shown here differ from the plasmid pUC19 shown in figure 17.10?
Bacterial artificial chromosome (BAC)
Figure 17.10
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Bacterial conjugation has medical consequences. For example, certain plasmids contain genes that code for toxins. The causative agent of a deadly form of food poisoning, E. coli 0157, synthesizes a toxin that causes massive bloody diarrhea and kidney failure. This toxin is now believed to have originated in Shigella, another bacterium that causes dysentery. Similarly, the growing problem of antibiotic resistance is partly attributable to the spread of antibioticresistant genes among bacterial populations. Antibiotic resistance develops because antibiotics are overused in medical practice and in livestock feeds. Suggest a mechanism by which this extensive use promotes antibiotic resistance.
In the Hershey Chase experiment, why was the localization of radio-labeled phage of macromolecules in the cytoplasm the reason that the genetic material identity was proved.
1 (a) What do ApR, TcR, and ori on the pBR322 map represent and discuss there individual functions?
(b)Does the undigested plasmid show more than a single band when electrophoresed? Why?
(c)What other kinds of molecules, in addition to plasmid DNA would you expect to find in a sample of plasmid DNA extraction? (This is not a graded assignment)
Chapter 17 Solutions
Prescott's Microbiology
Ch. 17.1 - Examine the uncut piece of DNA shown in the upper...Ch. 17.1 - Which of the above enzymes yield blunt ends? Which...Ch. 17.1 - Prob. 3MICh. 17.1 - What would you conclude if you obtained only blue...Ch. 17.1 - Why must introns be removed from eukaryotic DNA...Ch. 17.1 - Which plasmid is a shuttle vector? Why?Ch. 17.1 - In what ways does the BAC shown here differ from...Ch. 17.1 - Describe restriction enzymes, sticky ends, and...Ch. 17.1 - What is cDNA? Why is it necessary to generate cDNA...Ch. 17.1 - Prob. 3CC
Ch. 17.1 - Prob. 4CCCh. 17.1 - Prob. 5CCCh. 17.2 - Why, after three cycles, are the vast majority of...Ch. 17.2 - Briefly describe the polymerase chain reaction....Ch. 17.2 - Why is PCR used to detect infectious agents that...Ch. 17.2 - How would you use PCR to measure the concentration...Ch. 17.2 - Why is it possible to visualize a PCR product on...Ch. 17.2 - Prob. 5CCCh. 17.3 - Why are long fragments (e.g., 20,000 bp) of...Ch. 17.4 - What special considerations are necessary if one...Ch. 17.4 - Prob. 1CCCh. 17.4 - Prob. 2CCCh. 17.4 - Prob. 3CCCh. 17.4 - You are studying chemotaxis proteins in a newly...Ch. 17.5 - Prob. 1MICh. 17.5 - Prob. 1CCCh. 17.5 - Prob. 2CCCh. 17 - Which of the DNA molecules shown are recombinant?Ch. 17 - Prob. 1RCCh. 17 - Prob. 2RCCh. 17 - Prob. 3RCCh. 17 - Prob. 4RCCh. 17 - Prob. 5RCCh. 17 - Prob. 6RCCh. 17 - Prob. 1ALCh. 17 - Prob. 2ALCh. 17 - Suppose you transformed a plasmid vector carrying...Ch. 17 - You are interested in the activity and regulation...Ch. 17 - Prob. 5ALCh. 17 - Prob. 6ALCh. 17 - Prob. 7AL
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- You have two cell cultures, each containing a different plasmid. The first plasmid is ~5kbp long and contains three 5'-TCGA-3' and the other is the same size, but only contains two 5'-TCGA-3' sequences. You forget to label the two cell cultures you grew and have to figure out which one contains each plasmid. How would you go about identifying the the two cultures.arrow_forwarda) A plasmid DNA in bacteria has a length of 14,000 bp and an Lk of 1300. Calculate the superhelical density o for this plasmid. Show your work for partial credit, round to one digit after the decimal point. b) You use a Type II topoisomerase to change the linking number of this plasmid to 1310. How many turnovers must the topoisomerase perform? Is this resulting plasmid underwound or overwound?arrow_forwardYou are interested in synthesizing a variant of Synechocystis sp. pcc 7803 ferredoxin having mutation (E) at its 38th residue. The gene is encoded in a pET21b vector (5.3 kbp). If you use 0.10 ng of the template plasmid (pET21b SynFd), calculate the ratio of the original to the mutated gene after 10 versus 20 cycles.arrow_forward
- The genes for both the α- and βglobin chains of hemoglobin contain introns (i.e., they are split genes). How would this fact affect your plans if you wanted to introduce the gene for α-globin into a bacterial plasmid and have the bacteria produce α-globin?arrow_forwardIf the recipient cell did not already have a lys− gene, could the lys+ DNA become incorporated into the bacterial chromosome? Explain.arrow_forwardFigure 1 is a photography obtained after spreading the replicating Escherichia coli chromosome and its observation by transmission electron microscopy. An interpretation scheme of the observed structure is shown in the upper right part of the photo. Figure 1: Photography of a replicating Escherichia coli chromosome observed by transmission electron microscopy. 2 Indicate the replication properties that are shared by all living organisms What are the peculiarities of bacterial replicationarrow_forward
- In Figure 6-13, explain at the protein level why this heterokaryon can grow on minimal mediumarrow_forwardThe sequence below shows the ends of one strand of a linear chromosome, with slashes representing the middle part, which is not shown. During replication of this one strand, on which side of the slashes will Okazaki fragments be made in the newly synthesized strand? 5' AGCCGTACGGTTATCTCCTAG //// GGGCCTATTGTGACCAGTGAGTCG 3' a) Both sides b) Neither side c) The right side d) The left sidearrow_forwardIf deoxyribonucleotides that lack the 3’-OH groups are added during the replication process, what do you expect will occur? Describe what happens when a nonsense mutation is introduced into the gene encoding transposase within a transposon. A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice that the colony morphology is strikingly different on plates of minimal media with glucose compared to that seen on trypticase soy agar plates. How can you explain these differences in colony morphology?arrow_forward
- Three pairs of bacterial cells with the given genotypes undergo conjugation. Place match the genotype of each cell after conjugation to its initial genotype. F+ x F Hfr F- F' F- Answer Bank F F F+ Hfr What is the role of the F-factor in conjugation? It contains genes necessary for replication of the donor's F plasmid. can occur. It allows auxotrophic bacterial cells to survive on minimal medium so that conjugation It contains genes that force recombination between the donor and recipient chromosomes. It contains genes necessary for the formation of the pilus. O It degrades the chromosome of the recipient cell after conjugation.arrow_forwardIn Hershey-Chase experiment, bacteriophages protein coats were tagged with radioactive isotope S-32. These phages were used to infect E. coli cells and the cells were further centrifuged to form pellets. Why was the radioactivity level of S-32 found greater outside the cells compared to the E. coli cell pellets? Explain briefly. If the experiment is repeated in the same manner but this time the phage protein coats are labelled with isotope X and the phage DNA with isotope Y, which isotope’s radioactivity will be found in greater amounts in the E. coli cell pellets after centrifugation? Explain briefly.arrow_forwardIn the experiment below, flasks of human fibroblasts are either transfected with a control gene or the v-src gene. After 48 hrs the flasks (Top row) as well as microscope images of cells on surface of flask (bottom row) from the two different experiments are depicted. Which Flask (A or B) is from the v-src transfection? Justify in 3-4 sentences why you drew this conclusion. Flask A Flask B iumarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license