Concept explainers
DNA methylation is commonly associated with a reduction of transcription. The following data come from a study of the impact of the location and extent of DNA methylation on gene activity in eukaryotic cells. A bacterial gene, luciferase, was inserted into plasmids next to eukaryotic promoter fragments. CpG sequences, either within the promoter and coding sequence (transcription unit) or outside of the transcription unit, were methylated to various degrees, in vitro. The chimeric plasmids were then introduced into cultured cells, and luciferase activity was assayed. These data compare the degree of expression of luciferase with differences in the location of DNA methylation [Irvine et al. (2002). Mol. and Cell. Biol. 22:6689–6696]. What general conclusions can be drawn from these data?
Want to see the full answer?
Check out a sample textbook solutionChapter 17 Solutions
Concepts of Genetics (12th Edition)
- The design of antibiotics requires that the drug prevents the growth of bacteria without compromising cellular functions in humans. I’d like you to think of the differences in the process of gene expression in prokaryote and eukaryotes and suggest two possible targets for the design of an antibiotic. Explain what processes you are preventing (although we have only discussed transcription and translation, you can include replication if you’re familiar with this process) and how your drug would be targeted to affect prokaryotes only.arrow_forward3′-->5′ Exonuclease activity allows DNA polymerase III (Pol III) to back-up and fix a mismatched base pair that was just incorporated into a growing strand of new DNA. True Or False In one of the four ways to regulate gene expression, positive control with repression indicates that transcription is activated in the presence of a co-repressor. True Or Falsearrow_forwardWhat is the production of RNA called and what is the enzyme that catalyzes the process?What are the similarities and differences between the transcription process and the repli-cation processes?Concerning their biological function what is the difference between DNA and RNA? Is there any situation in which DNA is made based on a RNA template? If there is,explain with an example how it occurs and state the enzyme involved?What is the difference between plasma membrane and cell wall?arrow_forward
- Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.arrow_forwardThe mechanism for RNA-induced transcriptional silencing of heterochromatic DNA is paradoxical. For example, how does it make sense that centromeric DNA in fission yeast first needs to be transcribed before it can be transcriptionally silenced?arrow_forward5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…arrow_forward
- An electrophoretic mobility shift assay can be used to study the binding of proteins to a segment of DNA. In the results shown here, an EMSA was used to examine the requirements for the binding of RNA polymerase |l (from eukaryotic cells) to the promoter of a protein-encoding gene. The assembly of general transcription factors and RNA polymerase Il at the core promoter is described in Week 4. In this experiment, the segment of DNA containing a promoter sequence was 1100 bp in length. The fragment was mixed with various combinations of proteins and then subjected to an EMSA. Lane 1: No proteins added Lane 2: TFIID Lane 3: TFIIB Lane 4: RNA polymerase IIl Lane 5: TFIID + TFIIB Lane 6: TFIID + RNA 1 2 3 4 5 6. 7 polymerase II Lane 7: TFIID + TFIIB + RNA polymerase Il 1100 bp Explain the results.arrow_forwardSince RNA polymerase has an error rate of 1 / 10^4 nucleotides, and the DNA polymerase has an error rate of 1 / 10^7 nucleotides, can cells tolerate errors made in transcription in comparison to errors made during DNA replication?arrow_forwardConsider this list (below) of steps involved in transcription. These steps are out of order. TRANSCRIPTION: 1. mRNA travels through a nuclear pore and enters the cytoplasm 2. the mRNA polymerase attaches at the start of a specific gene 3. RNA polymerase reads the gene surface4. a transcription factor bonds to a promoter site5. DNA molecule is unwound 6. a complimentary mRNA is produced What is the correct order of this transcription?arrow_forward
- The presence of a DNA template (e.g. a product from PCR), general transcription factors, and RNA polymerase II allows for the initiation of transcription in vitro. Explain why the initiation of transcription is not possible with only general transcription factors and RNA polymerase II using the genomic DNA as a template.arrow_forwardHistone methylation can have many different effects on gene expression. In some cases, histone methylation is associated with activation of transcription, whereas in other cases it can trigger the formation of heterochromatin and a decrease in transcription. If histone methylation has been detected in the region of gene YFG in yeast, describe an experiment that could distinguish whether the methylation is important to activate or repress transcription of gene YFG.arrow_forwardYou made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…arrow_forward
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education