Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 17, Problem 20PDQ
DNA supercoiling, which occurs when coiling tension is generated ahead of the replication fork, is relieved by DNA gyrase. Supercoiling may also be involved in transcription regulation. Researchers discovered that enhancers operating over a long distance (2500 bp) are dependent on DNA supercoiling, while enhancers operating over shorter distances (110 bp) are not so dependent [Liu et al. (2001). Proc. Natl. Acad. Sci. USA 98:14,883–14,888]. Using a diagram, suggest a way in which supercoiling may positively influence enhancer activity over long distances.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Since RNA polymerase has an error rate of 1 / 10^4 nucleotides, and the DNA polymerase has an error rate of 1 / 10^7 nucleotides, can cells tolerate errors made in transcription in comparison to errors made during DNA replication?
List two possible reasons why a mistake during the process of replication is more of a catastrophe than a mistake in the process of transcription. What mechanisms help to ensure the fidelity of the process of replication?
Consider the Rho-dependent terminator sequence
5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription?
Group of answer choices
Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.
Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds.
Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination.
Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
Chapter 17 Solutions
Concepts of Genetics (12th Edition)
Ch. 17 - Cancer cells often have abnormal patterns of...Ch. 17 - The hormone estrogen converts the estrogen...Ch. 17 - Each year in the United States, there are over...Ch. 17 - Prob. 2CSCh. 17 - Each year in the United States, there are over...Ch. 17 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 17 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 17 - What features of eukaryotes provide additional...Ch. 17 - Provide a definition of chromatin remodeling, and...Ch. 17 - Describe the organization of the interphase...
Ch. 17 - A number of experiments have demonstrated that...Ch. 17 - Provide a brief description of two different types...Ch. 17 - Present an overview of the manner in which...Ch. 17 - Prob. 9PDQCh. 17 - Explain how the addition of acetyl groups to...Ch. 17 - Distinguish between the cis-acting regulatory...Ch. 17 - Prob. 12PDQCh. 17 - Describe the manner in which activators and...Ch. 17 - Compare the control of gene regulation in...Ch. 17 - Many promoter regions contain CAAT boxes...Ch. 17 - Prob. 16PDQCh. 17 - Prob. 17PDQCh. 17 - Many transcriptional activators are proteins with...Ch. 17 - Prob. 19PDQCh. 17 - DNA supercoiling, which occurs when coiling...Ch. 17 - Prob. 21ESPCh. 17 - Prob. 22ESPCh. 17 - Because the degree of DNA methylation appears to...Ch. 17 - A particular type of anemia in humans, called...Ch. 17 - Regulation of the lac operon in E. coli (see...Ch. 17 - DNA methylation is commonly associated with a...Ch. 17 - During an examination of the genomic sequences...Ch. 17 - Prob. 28ESPCh. 17 - Although a single activator may bind many...Ch. 17 - Hereditary spherocytosis (HS) is a disorder...Ch. 17 - Transcription factors play key roles in the...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- 5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…arrow_forwardAs described in Table, what is the difference between a rapidstop and a slow-stop mutant? What are different roles of the proteins that are defective in rapid-stop and slow-stop mutants?arrow_forwardWhen Laybourne and Kadonaga studied the effects of histone proteins on eukaryotic transcription using an in vitro transcription assay explain why: a) they used two different DNA templates that contained different promoter structures. b) when they included both activator protein and histones, they always added the histone proteins before adding the activator to the transcription assay mixture. (Ctri) -arrow_forward
- Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices 1.Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds. 2.Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. 3.Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. 4.Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination.arrow_forwardHow do you think that transcription randomizes positions of nucleosomes and repression restores the ordering after transcription? How might you test to see if there was an exchange of histone subunits during transcription or if the nucleosome is truly transferred as a single unit? Would you expect the DNA band representing the distance from the restriction enzyme site to the hypersensitive site to be a single band or a smear? Defend your answer.arrow_forwardDNA polymerases are capable of editing and error correction, meaning it is able to edit and correct single base error so that the gene is not affected. However, RNA polymerase has a limited capacity for error correction. Given that a single base error in either replication or transcription can lead to error in protein synthesis, suggest a brief explanation for this difference in the capability of error correction between DNA polymerase and RNA polymerase.arrow_forward
- Glenn Croston and his colleagues studied the relation between chromatin structure and transcription activity. In one set of experiments, they measured the level of in vitro transcription of a Drosophila gene by RNA polymerase II in the presence of DNA and various combinations of histone proteins (G. E. Croston et al. 1991. Science 251:643–649). First, they measured the level of transcription of naked DNA, with no associated histone proteins. Then they measured the level of transcription after nucleosome octamers (without H1) were added to the DNA. The addition of the octamers caused the level of transcription to drop by 50%. When both nucleosome octamers and H1 proteins were added to the DNA, transcription was greatly repressed, dropping to less than 1% of that obtained with naked DNA, as shown in the table below. GAL4-VP16 is a protein that binds to the DNA of certain eukaryotic genes. When GAL4-VP16 is added to DNA, the level of transcription by RNA polymerase II is greatly elevated.…arrow_forwardTransformation is a process in which bacteria take up new DNA released by dead cells and integrate it into their own genomes (see p. 265 in Chapter 9). In Streptococcus pneumoniae (which causes many cases of pneumonia, inner-ear infections, and meningitis), the ability to carry out transformation requires from 105 to 124 genes, collectively termed the com regulon. The com regulon is activated in response to a protein called competence-stimulating peptide (CSP), which is produced by the bacteria and exported into the surrounding medium. When enough CSP accumulates, it attaches to a receptor on the bacterial cell membrane, which then activates a regulator protein that stimulates the transcription of genes within the com regulon and sets in motion a series of reactions that ultimately result in transformation. Does the com regulon in Streptococcus pneumoniae exhibit positive or negative control? Explain your answer.arrow_forwardAn article entitled “Nucleosome Positioning at the Replication Fork” states: “both the ‘old’ randomly segregated nucleosomes as well as the ‘new’ assembled histone octamers rapidly position themselves (within seconds) on the newly replicated DNA strands” [Lucchini et al. (2002)]. Given this statement, how would one compare the distribution of nucleosomes and DNA in newly replicated chromatin? How could one experimentally test the distribution of nucleosomes on newly replicated chromosomes?arrow_forward
- Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′arrow_forwardFf.252.arrow_forwardTranscription is thus the final stage of gene expression involves interactions between three types of RNA molecules (mRNA templates, tRNAs, and rRNAs). Xeroderma Pigmentosum is a premature aging disease that begins in adolescence or early adulthood and results in the appearance of old age by 30-40 years of age. In the lagging strand, the enzyme X removes RNA primers attached by Primase and this gap is then filled in by DNA Polymerase I. The enzyme X is topoisomerase. The ribosomes of prokaryotes are usually found in the rough ER and cytoplasm. Write T if the statement is true and write F if the statement is falsearrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY