Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Videos
Textbook Question
Chapter 17, Problem 18P
Lysine 4 of histone H3 (H3K4) is methylated in the nucleosomes of many transcriptionally active genes. Suppose you want to determine all the places in the human genome where nucleosomes contain methylated H3K4.
| a. | Starting with an antibody that specifically binds only to the tails of histone H3s that have K4 methylation, what kind of experiment would you perform? Outline the major steps of this experiment. |
| b. | Do you think that you would get the same results if your starting material was skin cells in one experiment and blood precursor cells in a second experiment? Explain. |
| c. | Describe a follow-up experiment that could determine if your data from part (a) are consistent with the idea that H3K4 methylation marks appear only at transcriptionally active genes. |
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
You would like to add a nuclear localization sequence (NLS) of Lys-Lys-Lys-Arg-Lys to a
protein that is usually found in the cytoplasm of a yeast cell. To accomplish this, you
introduce the nucleotide sequence encoding the NLS into the gene that encodes the
cytoplasmic protein of interest.
a. What is the size of the nucleotide insert that will encode the NLS? Briefly explain.
5'
3'
b. Below is a diagram of the gene encoding the cytoplasmic protein of interest in
the yeast genome. If your goal is to put the NLS at the carboxyl (C) terminus of
the protein, at which location (A-E) should the NLS be inserted? Briefly explain.
A
TATAA
ATATT
promoter
+1
B
ATG
TAC
D
TAA
ATT
stop
codon
E
3'
5'
In the first figure of “DNMT3L Connects Unmethylated Lysine 4 of Histone H3 to de novo Methylation of DNA,” the authors determined that the DNMT3L protein interacts with several histone proteins. Using Figure a and b (from that paper), explain how each of the 4 histones interact with DNMT3L.
When the amino acid levels in eukaryotic cells are low, general protein synthesis is reduced. Gcn4 translation, however, is increased.
A. What would happen under high and low amino acid conditions if only one of the upstream ORFs were deleted from Gcn4?
B. What would happen under high and low amino acid conditions if all of the upstream ORFs were deleted from Gcn4?
Chapter 17 Solutions
Genetics: From Genes to Genomes
Ch. 17 - For each of the terms in the left column, choose...Ch. 17 - For each of the following types of gene...Ch. 17 - List five events other than transcription...Ch. 17 - Which eukaryotic RNA polymerase RNA pol I, pol II,...Ch. 17 - As shown in the following diagram, a single...Ch. 17 - You have synthesized an enhancerless GFP reporter...Ch. 17 - Prob. 7PCh. 17 - Prob. 8PCh. 17 - A single UAS regulates the expression of three...Ch. 17 - MyoD is a transcriptional activator that turns on...
Ch. 17 - a. Assume that two transcription factors are...Ch. 17 - Prob. 12PCh. 17 - In Problem 12, you identified a genomic region...Ch. 17 - Prob. 14PCh. 17 - Prob. 15PCh. 17 - Genes in both prokaryotes and eukaryotes are...Ch. 17 - Prob. 17PCh. 17 - Lysine 4 of histone H3 H3K4 is methylated in the...Ch. 17 - J.T. Lis and collaborators have developed an...Ch. 17 - Hydatiform moles are growths of undifferentiated...Ch. 17 - Prader-Willi syndrome is caused by a mutation in...Ch. 17 - The human IGF2 gene is autosomal and maternally...Ch. 17 - Follow the expression of a paternally imprinted...Ch. 17 - Reciprocal crosses were performed using two inbred...Ch. 17 - Interestingly, imprinting can be tissue-specific....Ch. 17 - Prob. 26PCh. 17 - A method for detecting methylated CpGs involves...Ch. 17 - Honeybees Apis mellifera provide a striking...Ch. 17 - Consider the experiment in Fig. 17.24, where the...Ch. 17 - A protein or RNA that regulates gene expression in...Ch. 17 - a. How can a single eukaryotic gene give rise to...Ch. 17 - A hunchback gene, a gene necessary for proper...Ch. 17 - You know that the mRNA and protein produced by a...Ch. 17 - You are studying a transgenic mouse strain that...Ch. 17 - Prob. 35PCh. 17 - Scientists have exploited the siRNA pathway to...Ch. 17 - Persimmons Diospyros lotus are dioecious plants,...Ch. 17 - Drosophila females homozygous for loss-of-function...Ch. 17 - The text has discussed the RNA-Seq technique,...Ch. 17 - Researchers know that Fru-M controls male sexual...Ch. 17 - The Drosophila gene Sex lethal Sxl is deserving of...Ch. 17 - Figure 17.29 shows that the Sxl protein binds to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explainarrow_forwardAs part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explainarrow_forwardYou have the following DNA coding sequence of a wild-type allele: 5’-ATG TTC CAG CTA GAT GAT ATG CTG GTA ATT GGG GAA CGC GCG CGG TAA-3’ For each of the following mutations: A. State whether the mutation is missense, nonsense, frameshift, or silent. B. Write the codon change that occurs for the missense, nonsense, and silent mutations (ex. GAA -- GAT). C. For frameshift mutations, write out the entire mutant sequence with each codon clearly indicated (if the frameshift creates a new stop codon, end the sequence at the new stop). Using the wild type DNA sequence above as a guide : Write the amino acid sequence of the mutants. Mutant 1: transition at nucleotide 23 Mutant 2: T --> G transversion at nucleotide 29 Mutant 3: an insertion of “A” after nucleotide 14 Mutant 4: transition at nucleotide 7 Mutant 5: An insertion of GG after nucleotide 40 Mutant 6: transition at nucleotide 15 Mutant 7: a deletion of nucleotide 25arrow_forward
- You have created three different mutations in the histoneH1 protein (HISmut1, HISmut2, HISmut3), and each of these mutations eliminate a stretch of 5 amino acids from the primary sequence. Based on the description of where you find the mutant histoneH1 proteins when you look inside a cell in each of the cases below, describe 1) what the function is of the amino acids that were removed, and 2) what is not happening with the mutant histoneH1 protein that does happen with wild type H1: 1. HISmut2 protein is found in the cytoplasm, and never in the nucleus. 2. HISmut1 protein is found in only briefly in the cytoplasm because it is very quickly sent to the proteasome. 3. HISmut3 protein is found floating freely throughout the nucleoplasm.arrow_forwardBelow is a DNA sequence of the coding strand for a small gene. This gene has no introns. +1 5'- TATAAGATGCGTAGGATGCAGCTGTTTCAGCAGCCACGGTCTCGGCCCAGATAGCAGATAATAAACACGC GTA-3 a. Is this gene for an eukaryote or a prokaryote? Give one reason (. b. How many amino acids are expected to be coded by this gene? c. There are five underlined nucleotide sequences, interpret the purpose of three of them ONLY?arrow_forwardIn the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forward
- Zidovudine (AZT) is a drug used to treat patients with AIDS. AZT works by blocking the reverse-transcriptase enzyme used by the human immunodeficiency virus (HIV), the causative agent of AIDS. Do you expect that AZT would have any effect on transposable elements? If so, what type of transposable elements would be affected, and what would be the most likely effect?arrow_forwardThe figure below represents a cell undergoing gene expression. Use the figure to answer the questions that follow (a - e). a. What is indicated by label (2) in the figure above? b. What is indicated by label (3) in the figure above? c. What happens to the part labelled (3) and what complex makes it happen? d. Which amino acid is represented by (6)? e. Give the one anticodon in the 5' to 3' direction that will recognize all the codons for this amino acid in (c)arrow_forwardTo identify the following types of genetic occurrences, would acomputer program use sequence recognition, pattern recognition,or both?A. Whether a segment of Drosophila DNA contains a P element(which is a specific type of transposable element)B. Whether a segment of DNA contains a stop codonC. In a comparison of two DNA segments, whether there is aninversion in one segment compared with the other segmentD. Whether a long segment of bacterial DNA contains one ormore genesarrow_forward
- In cells, certain hormones, such as epinephrine, have the ability to raise the concentration of cAMP. The CREB protein can be found in a cell extract that has been pretreated with epinephrine or not, depending on your preference.Using an electrophoretic mobility shift experiment, you test the CREB protein's capacity to attach to a DNA fragment containing a cAMP response element (CRE). Specify what you hope to achieve.arrow_forwarda molecular geneticist hopes to find a gene in human liver cells that codes for an important blood-clotting protein. he knows that the nucleotide sequence of a small part of the gene is gtggactgaca. briefly explain how to obtain the desired gene answerarrow_forwardYou are studying a large eukaryotic gene that is 439,515 base pairs long. You find the polypeptide that this gene produces in liver cells is 46,771 amino acids long. Your colleague studies the function of this gene in brain cells, and finds the polypeptide produced in the brain is much larger – 61,438 amino acids long. How do you explain this difference? Possible Answers: A. The cell cycle of liver cells is much longer than that of brain cells. B. This is due to alternative splicing. in the brain C. There was a different complement of sequence-specific transcription factor binding sites in the CRM of the brain cells. D. There is no 5' cap added to the gene product from the liver cells.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
QCE Biology: Introduction to Gene Expression; Author: Atomi;https://www.youtube.com/watch?v=a7hydUtCIJk;License: Standard YouTube License, CC-BY