Genetics: From Genes to Genomes
6th Edition
ISBN: 9781259700903
Author: Leland Hartwell Dr., Michael L. Goldberg Professor Dr., Janice Fischer, Leroy Hood Dr.
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 17, Problem 33P
You know that the mRNA and protein produced by a particular gene are present in brain, liver, and fat cells, but you detect an enzymatic activity associated with this protein only in fat cells. Provide a possible explanation for this phenomenon.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
Messenger RNA molecules are very difficult to isolate in bacteria because they are rather quickly degraded in the cell. Can you suggest a reason why this occurs? Eukaryotic mRNAs are more stable and exist longer in the cell than do bacterial mRNAs. Is this an advantage or a disadvantage for a pancreatic cell making large quantities of insulin?
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example.
ATGATAGCCAGACTCGCA
The following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some
tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with
an example.
ATGATAGCACCAGACTCGCA
Chapter 17 Solutions
Genetics: From Genes to Genomes
Ch. 17 - For each of the terms in the left column, choose...Ch. 17 - For each of the following types of gene...Ch. 17 - List five events other than transcription...Ch. 17 - Which eukaryotic RNA polymerase RNA pol I, pol II,...Ch. 17 - As shown in the following diagram, a single...Ch. 17 - You have synthesized an enhancerless GFP reporter...Ch. 17 - Prob. 7PCh. 17 - Prob. 8PCh. 17 - A single UAS regulates the expression of three...Ch. 17 - MyoD is a transcriptional activator that turns on...
Ch. 17 - a. Assume that two transcription factors are...Ch. 17 - Prob. 12PCh. 17 - In Problem 12, you identified a genomic region...Ch. 17 - Prob. 14PCh. 17 - Prob. 15PCh. 17 - Genes in both prokaryotes and eukaryotes are...Ch. 17 - Prob. 17PCh. 17 - Lysine 4 of histone H3 H3K4 is methylated in the...Ch. 17 - J.T. Lis and collaborators have developed an...Ch. 17 - Hydatiform moles are growths of undifferentiated...Ch. 17 - Prader-Willi syndrome is caused by a mutation in...Ch. 17 - The human IGF2 gene is autosomal and maternally...Ch. 17 - Follow the expression of a paternally imprinted...Ch. 17 - Reciprocal crosses were performed using two inbred...Ch. 17 - Interestingly, imprinting can be tissue-specific....Ch. 17 - Prob. 26PCh. 17 - A method for detecting methylated CpGs involves...Ch. 17 - Honeybees Apis mellifera provide a striking...Ch. 17 - Consider the experiment in Fig. 17.24, where the...Ch. 17 - A protein or RNA that regulates gene expression in...Ch. 17 - a. How can a single eukaryotic gene give rise to...Ch. 17 - A hunchback gene, a gene necessary for proper...Ch. 17 - You know that the mRNA and protein produced by a...Ch. 17 - You are studying a transgenic mouse strain that...Ch. 17 - Prob. 35PCh. 17 - Scientists have exploited the siRNA pathway to...Ch. 17 - Persimmons Diospyros lotus are dioecious plants,...Ch. 17 - Drosophila females homozygous for loss-of-function...Ch. 17 - The text has discussed the RNA-Seq technique,...Ch. 17 - Researchers know that Fru-M controls male sexual...Ch. 17 - The Drosophila gene Sex lethal Sxl is deserving of...Ch. 17 - Figure 17.29 shows that the Sxl protein binds to...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Consider the mechanism of the enzyme RNase: What would happen to the Km (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a lysine? Explain. What would happen to the Kcat (i.e., would it increase, decrease, or stay the same) if the his12 was mutated to a valine? Explain.arrow_forwardHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. Give an example of how a mutation that altered the splicing sites in the pre-mRNA might lead to a premature stop codon in the gene.arrow_forwardHemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. Is it likely that the mutation has altered at least one base at the exon-intron boundary in the wild-type pre-mRNA? Why or why not?arrow_forward
- Describes a method known as Western blotting that can be used to detect a polypeptide that is translated from a particular mRNA. In this method, a particular polypeptide or protein is detected by an antibody that specifically recognizes a segment of its amino acid sequence. After the antibody binds to the polypeptide within a gel, a secondary antibody (which is labeled) is used to visualize the polypeptide as a dark band.For example, an antibody that recognizes α-galactosidase A couldbe used to specifically detect the amount of α-galactosidase A proteinon a gel. The enzyme α-galactosidase A is defective in individuals with Fabry disease, which shows an X-linked recessive pattern of inheritance. Amy, Nan, and Pete are siblings, and Pete has Fabry disease. Aileen, Jason, and Jerry are brothers and sister, and Jerry has Fabry disease. Amy, Nan, and Pete are not related to Aileen, Jason, and Jerry. Amy, Nan, and Aileen are concerned that they could be carriers of a defective…arrow_forwardThe following is the only intron sequence of a gene that will be excised during the maturation of the mRNA. But it is not spliced in some tissues, where alternative splicing pattern is seen. Will the amino acid of its protein product following this sequence change? Explain with an example. ATAAGCCAGACTCAGCAarrow_forwardConsider a stretch of DNA (a hypothetical gene) that has the sequence 5’ ATG-CTA-TCA-TGG-TTC-TAA 3’ A) Transcribe and translate this gene using the genetic code table. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. B) Now, our hypothetical gene has undergone a mutation. The mutant sequence is....3’ TAC-GAT-AGT-ACC-AAT-ATT 5’5’ ATG-CTA-TCA-TGG-TTA-TAA 3’ Transcribe and translate the mutant sequence. Be sure to label the mRNA 3’ and 5’ ends. Write the amino acid sequence using 1 letter abbreviations. C) Indicate the type of mutation (nonsense, missense, silent, or frame shift) present. D) How severe of a consequence will this mutation likely be in terms of protein function (none, mild, moderate or severe)? Why?arrow_forward
- In eukaryotes there is not a consistent relationship between the length of the coding sequence of a gene and the length of the mature mRNA it encodes, even though one nucleotide in DNA = one nucleotide in pre-mRNA or primary transcript. Explain why this is so.arrow_forwardHere is the model for TfR mRNA regulation (see Fig.), for your convenience. Orange protein (IRP or IREBP), when bound to RNA, protects mRNA from degradation. When Fe is bound to the protein, it cannot bind the mRNA. If you made a radioactive DNA probe specific to TfR mRNA and performed a Northern blot analysis (to detect mRNA) from cells treated with high iron (Fe) concentration what would you expect to see? (a) Low iron RNase A (b) High iron O High levels of RNase O Low levels of TfR mRNA Fe RNase O The result would be the same as untreated cells Degradation O High levels of IRP (or IREBP - iron responsive element binding protein) O High levels of TfR mRNAarrow_forwardHow is it possible that a given mRNA in a cell is found throughout the cytoplasm but the protein that it encodes is only found in a few specific regions of the cytoplasm? Cite a few different possibilities.arrow_forward
- Hemophilia in the Russian royal family was caused by defective protein involved in blood clotting (factor IX). This defective protein was caused by a mutation that altered the splicing of the exons. This genetic change in the splicing pattern created a new stop codon in the mRNA for factor IX. What effect might this new stop codon have on the primary and tertiary levels of the mutant factor IX protein (compared to the native or wild-type protein).arrow_forwardAnother thalassemic patient had a mutation leading to the production of an mRNA for the β chain of hemoglobin that was 900 nucleotides longer than the normal one. The poly(A) tail of this mutant mRNA was located a few nucleotides after the only AAUAAA sequence in the additional sequence. Propose a mutation that would lead to the production of this altered mRNA.arrow_forwardKnowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human β-globin gene (Shown in Figure 17.11) into bacterial cells, hoping the cells will express it and synthesize functional β-globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does β-globin made by a eukaryotic cell. Explain why.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSONBiology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStaxAnatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
- Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & CompanyLaboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license