The region that contains the promoter and a neuronal enhancer in the tissue culture. Introduction: The promoter is a small DNA sequence where the RNA polymerase enzyme bind for the process of transcription. The prokaryotes have TATA box and Pribnow box as their promoter regions. These are unaltered and conserved sequences.

Question

Want to see the full answer?

Answer 1

Question

Chapter 17, Problem 7P

Summary Introduction

To determine:

The region that contains the promoter and a neuronal enhancer in the tissue culture.

Introduction:

The promoter is a small DNA sequence where the RNA polymerase enzyme bind for the process of transcription. The prokaryotes have TATA box and Pribnow box as their promoter regions. These are unaltered and conserved sequences.

Expert Solution & Answer

Want to see the full answer?

Check out a sample textbook solution

See solution

Students have asked these similar questions

You made four mutants for a promoter sequence in DNA and studied them for transcription. The results of the amount of gene expression or transcription (based on beta-Gal activity shown on Y-axis) for these DNAs (X-axis) are shown. The sequence of the wild-type and mutant DNAs, and consensus sequence from many promoters are shown here for your convenience. From this experiment you can conclude that: Nucleotide substitution can identify important bases of the binding sites or promoter in DNA (e.g., -10 and -35 promoter sequences of lac operon). True or false: Spacer (a) -10 region -35 region TTGACA Consensus sequence TATAAT Wild-type Lac promoter GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATT Mutant 1 GGCTTTACACTTTATG-TTCCGGCTCGTATGTTGTGTGGAATT Mutant 2 GGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATT Mutant 3 GGCTTTACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT Mutant 4 GGCTTGACACTTTATG-TTCCGGCTCGTATAATGTGTGGAATT (b) 700 600- 500- 400- 300- 200- 100. 0 ● True O False B-Galactosidase activity Wild-type…

An electrophoretic mobility shift assay can be used to study the binding of proteins to a segment of DNA. In the results shown here, an EMSA was used to examine the requirements for the binding of RNA polymerase |l (from eukaryotic cells) to the promoter of a protein-encoding gene. The assembly of general transcription factors and RNA polymerase Il at the core promoter is described in Week 4. In this experiment, the segment of DNA containing a promoter sequence was 1100 bp in length. The fragment was mixed with various combinations of proteins and then subjected to an EMSA. Lane 1: No proteins added Lane 2: TFIID Lane 3: TFIIB Lane 4: RNA polymerase IIl Lane 5: TFIID + TFIIB Lane 6: TFIID + RNA 1 2 3 4 5 6. 7 polymerase II Lane 7: TFIID + TFIIB + RNA polymerase Il 1100 bp Explain the results.

You then make a screen to identify potential mutants (shown as * in the diagram) that are able to constitutively activate Up Late operon in the absence of Red Bull and those that are not able to facilitate E. Coli growth even when fed Red Bull. You find that each class of mutations localize separately to two separate regions. For those mutations that prevent growth even when fed Red Bull are all clustered upstream of the core promoter around -50 bp. For those mutations that are able to constitutively activate the operon in the absence of Red Bull are all located between the coding region of sleep and wings. Further analysis of each DNA sequence shows that the sequence upstream of the promoter binds the protein wings and the region between the coding sequence of sleep and wings binds the protein sleep. When the DNA sequence of each is mutated, the ability to bind DNA is lost. Propose a final method of gene regulation of the Up Lateoperon using an updated drawn figure of the Up Late…