Concepts of Genetics (12th Edition)
12th Edition
ISBN: 9780134604718
Author: William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, Darrell Killian
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 15, Problem 30ESP
It has been noted that most transposons in humans and other organisms are located in noncoding regions of the genome—regions such as introns, pseudogenes, and stretches of particular types of repetitive DNA. There are several ways to interpret this observation. Describe two possible interpretations. Which interpretation do you favor? Why?
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions?
1) Define the silent mutation in DNA?
2) What is the codon usage bias?
3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics? (Explain in details)
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on
phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide
answers for the following questions?
1) Define the silent mutation in DNA?
2) What is the codon usage bias?
3) Provide one example of a clinical implication of a "silent mutation" that proven to have an effect on
the phenotype and provide a brief description of its molecular characteristics?
Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages (using 1.5 line space of Arial or Times New Roman fonts) provide answers for the following questions?
1) Define the silent mutation in DNA?
2) What is the codon usage bias?
3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype andprovide a brief description of its molecular characteristics?
Chapter 15 Solutions
Concepts of Genetics (12th Edition)
Ch. 15 - If a point mutation occurs within a human egg cell...Ch. 15 - One of the most famous cases of an X-linked...Ch. 15 - The cancer drug melphalan is an alkylating agent...Ch. 15 - Geneticists often use the alkylating agent...Ch. 15 - Six months pregnant, an expectant mother had a...Ch. 15 - Six months pregnant, an expectant mother had a...Ch. 15 - HOW DO WE KNOW? In this chapter, we focused on how...Ch. 15 - CONCEPT QUESTION Review the Chapter Concepts list...Ch. 15 - What is a spontaneous mutation, and why are...Ch. 15 - Prob. 4PDQ
Ch. 15 - Prob. 5PDQCh. 15 - Why is a random mutation more likely to be...Ch. 15 - Most mutations in a diploid organism are...Ch. 15 - What is the difference between a silent mutation...Ch. 15 - Describe a tautomeric shift and how it may lead to...Ch. 15 - Contrast and compare the mutagenic effects of...Ch. 15 - Why are frameshift mutations likely to be more...Ch. 15 - Why are X rays more potent mutagens than UV...Ch. 15 - DNA damage brought on by a variety of natural and...Ch. 15 - Contrast the various types of DNA repair...Ch. 15 - Mammography is an accurate screening technique for...Ch. 15 - A significant number of mutations in the HBB gene...Ch. 15 - Describe how the Ames test screens for potential...Ch. 15 - Prob. 18PDQCh. 15 - Compare DNA transposons and retrotransposons. What...Ch. 15 - Prob. 20PDQCh. 15 - In maize, a Ds or Ac transposon can alter the...Ch. 15 - Prob. 22PDQCh. 15 - In a bacterial culture in which all cells are...Ch. 15 - Presented here are hypothetical findings from...Ch. 15 - Prob. 25ESPCh. 15 - Prob. 26ESPCh. 15 - What evidence indicates that mutations in human...Ch. 15 - Among Betazoids in the world of Star Trek, the...Ch. 15 - Skin cancer carries a lifetime risk nearly equal...Ch. 15 - It has been noted that most transposons in humans...Ch. 15 - Mutations in the IL2RG gene cause approximately 30...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Silent mutations that occur in DNA are quite common in living cells and usually involve no effects on phenotype. In not more than 2 pages provide answers for the following questions?( please answer all the parts 1, 2 and 3) : 1) Define the silent mutation in DNA? 2) What is the codon usage bias? 3) Provide one example of a clinical implication of a “silent mutation” that proven to have an effect on the phenotype and provide a brief description of its molecular characteristics?arrow_forwardWhile characterizing a mutation in a gene of interest, you discover that the mutation involves an insertion within the coding sequence of the gene. You suspect that the inserted sequence is a transposon and would like to determine which of the three major transposon families it belongs to. What sequence elements could be looked for within the inserted sequence that would help place it in one of the three families?arrow_forwardThe D1S80 locus is located on human chromosome 1 and is characterized by a repeating 16 base pair (bp) sequence. Alleles for this locus vary depending on the number of repeats present, thus affecting the size of the locus. The D1S80 locus also contains two conserved sequences, a 32bp sequence at one end and a 113bp sequence at the other end. If the DNA of an individual is targeted for D1S80 amplification, and one of the resulting amplicons is approximately 785bp in size, how many repeats would be present in this D1S80 allele? The amplicon of interest is indicated by a red arrow in the diagram below.arrow_forward
- Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?arrow_forwardWhich of the following set(s) of primers a-d could you use to amplify the following target DNA sequence, which is part of the last protein-coding exon of the CFTR gene? Explain briefly. (Note: The three dots represent the body of the region to be amplified, whose beginning and end are only being shown.) 5' GGCTAAGATCTGAATTTTCCGAG . TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC . AACCCGTTATTACATCGCGGAA 5' a. 5' GGAAAATTCAGATCTTAG 3'; 5' TGGGCAATAATGTAGCGC 3' b. 5' GCTAAGATCTGAATTTTC 3'; 3' ACCCGTTATTACATCGCG 5' c. 3' GATTCTAGACTTAAAGGC 5'; 3' АССCGTTATTАСАТСGCG 5 d. 5' GCTAAGATCTGAATTTTC 3'; 5' TGGGCAATAATGTAGCGC 3'arrow_forwardThe following four mutations have been discovered in a gene that has more than 60 exons and encodes a very large protein of 2532 amino acids. Indicate which mutation would likely cause a detectable change in the size of the mRNA and/or the size of the protein product. Consider a detectable change to be >10% of the wild-type size. A table of the genetic code is shown below. First letter 0 00 U O A บบบ UUC UUA UUG U CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu >Leu AUU AUC lle AUA AUG Met >Val UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Second letter C Ser Pro Thr Ala CAU CAC CAA CAG UAU UGU Tyr UAC UGC UAA Stop UGA UAG Stop UGG AAU AAC AAA AAG A GAU GAC GAA GAG His Gin Asn Lys Asp G Glu CGU CGC CGA CGGJ AGU AGC AGA AGG GGU GGC GGA GGG O AAG576UAG (changes codon 576 from AAG to UAG) Cys Stop Trp O GUG326AUG (changes codon 326 from GUG to AUG) Arg Ser Arg Gly DUAG DUA G DCAG DO AG deletion of codon 779 insertion of 1000 base pairs into the sixth intron (this particular…arrow_forward
- Help me pleasearrow_forwardThe human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forwardThere are five substitution mutations in the dark-colored mutant Mc1r gene. Compare the DNA sequence of the light-colored wild-type Mc1r gene with the DNA sequence of the dark-colored mutant Mc1r gene. Indicate the locations of the five mutations by changing the font color to YELLOW for the five single DNA nucleotides that are mutated in the mutant Mc1r gene table. Using the information in the introduction, determine whether each of these mutations is a silent, missense, or nonsense mutation. Using the mutant Mc1r gene data, fill in the columns (including DNA, mRNA, and amino acid) in gene table 2 that contain a silent mutation with BLUE. Likewise, fill in the columns that contain a missense mutation with RED. Shade any columns that contain nonsense mutations with GREEN. Then Of the five mutations you identified in the mutant Mc1r gene, how many are: substitutions insertions deletions (Enter a number on each line.) 2. Of the five mutations…arrow_forward
- A molecular geneticist hopes to find a gene gene in human liver cells that codes for an important blood clotting protein. He knows that the nucleotides sequence of a small part of the gene is GTGGACTGACA. briefly explain how to obtain the desired genearrow_forwardA wildtype gene produces the polypeptide sequence: Wildtype: Met-Ser-Pro-Arg-Leu-Glu-Gly Each of the following polypeptide sequences is the result of a single mutation. Identify the most likely type of mutation causing each, be as specific as possible. M1:Met-Ser-Ser-Arg-Leu-Glu-Gly missense mutation M2:Met-Ser-Pro M3:Met-Ser-Pro-Asp-Trp-Arg-Asp-Lys M4:Met-Ser-Pro-Glu-Gly nonsense mutation frameshift insertion in frame deletion M5:Met-Ser-Pro-Arg-Leu-Glu-Gly in frame insertionarrow_forwardIn the table below, there are four versions of gene A, one of which is normal, and the other three which contain mutations that make the gene product nonfunctional. Focus on the shaded region of the sequence. Use the genetic code table to answer the question. How would you describe Mutation #2? Partial DNA sequence for gene A ("..." indicates many nucleotides of sequence not shown) 5' ... ATG GTG AGC AAG GAG GAG CTG TTC ACC TGT AAA TAG ... Normal Mutation #1 5' ... ATG GTG AGC AAG GAG AAG CTG TTC ACC TGT AAA TAG ... Mutation #2 5' ... ATG GTG AGC AAG TAG GAG CTG TTC ACC TGT AAA TAG ... Mutation #3 5' ... ATG GTG AGC AAG GAG CTG TTC ACC TGT AAA TAG ... Silent mutation Nonsense mutation Frameshift mutations Missense mútationarrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License