Genetic Analysis: An Integrated Approach (3rd Edition)
3rd Edition
ISBN: 9780134605173
Author: Mark F. Sanders, John L. Bowman
Publisher: PEARSON
expand_more
expand_more
format_list_bulleted
Concept explainers
Textbook Question
Chapter 10, Problem 2P
The human genome contains contains
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solutionStudents have asked these similar questions
The DNA chromosome in E. coli contains approximately 4 million base pairs. The average gene contains about 1500 base pairs. Use this information to calculate the following (show all work ):
a) The length in meters of this chromosome.
b) The approximate number of genes in the chromosome (assuming no wasted DNA).
A diploid human cell contains approximately 6.4 billion base pairs of DNA.
Assuming that the linker DNA encompasses 35 bp, how many nucleosomes are present in such a cell? Use two significant figures. How many histone proteins are complexed with this DNA? use two significant figures.
In not more than 200 words, explain how the human genome of 3.4 Gb would be in 2.3 meters long when stretched linearly if this size is fit into a cell of minuscule proportions.
Chapter 10 Solutions
Genetic Analysis: An Integrated Approach (3rd Edition)
Ch. 10 - 10.1 Give descriptions for the following...Ch. 10 - 10.2 The human genome contains contains base...Ch. 10 - In eukaryotic DNA, Where are you most likely to...Ch. 10 - 10.4 Describe the importance of light and dark G...Ch. 10 - Human late prophase karyotypes have about 2000...Ch. 10 - Prob. 6PCh. 10 - From the following list, identify the types...Ch. 10 - 10.8 If the haploid number for a plant species is...Ch. 10 - Mating between a male donkey (2n=64) and a female...Ch. 10 - A researcher interested in studying a human gene...
Ch. 10 - 10.11 In what way does position effect variegation...Ch. 10 - 10.12 A pair of homologous chromosomes in...Ch. 10 - 10.13 An animal heterozygous for a reciprocal...Ch. 10 - Dr. Ara B. Dopsis has an idea he thinks will be a...Ch. 10 - A normal chromosome and its homolog carrying a...Ch. 10 - The accompanying chromosome diagram represents a...Ch. 10 - 10.17 Histone protein isolated from pea plants...Ch. 10 - 10.18 A survey of organisms living deep in the...Ch. 10 - In humans that XX/XO mosaics, the phenotype is...Ch. 10 - 10.20 A plant breeder would like to develop the...Ch. 10 - In Drosophilia, seven partial deletion (1to7)...Ch. 10 - Two experimental varieties of strawberry are...Ch. 10 - 10.23 In the tomato, Solanum esculentum, tall ()...Ch. 10 - A boy with Down syndrome (trisomy 21) has 46...Ch. 10 - Experimental evidence demonstrates that the...Ch. 10 - Prob. 26PCh. 10 - Genomic DNA from the nematode worm...Ch. 10 - 10.28 A small population of deer living on an...Ch. 10 - A eukaryote with a diploid number of 2n=6 carries...Ch. 10 - Prob. 30PCh. 10 - For the following crosses, determine as accurately...Ch. 10 - A healthy couple with a history of three previous...
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The human genome (3.4 Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell of minuscule proportions.arrow_forwardA diploid organism with a 45,000-kb haploid genome contains 21% G residues. Calculate the number of A, C, G, and T residues in the DNA of each cell in this organism.arrow_forwardThe axial ratio is a term used to describe a rod-shaped molecule using the ratio of its length to its diameter. Given that the standard conformation of DNA in a physiological solution has a diameter of 2.37 nm, what is the axial ratio of the longest chromosome of Drosophila melanogaster DNA, which is 21000 µm long? Please record your answer in scientific notation. axial ratio: x10arrow_forward
- For a linear B-DNA molecule of 50,000 kb, calculate (a) the contour length and (b) the length of the DNA as packaged in nucleosomes with linker histones present.arrow_forwardGiven the fact that 1 fg of DNA = 9.78 * 105base pairs (on average), you can convert the amount of DNA per cell to the lengthof DNA in numbers of base pairs. (a) Calculate the number of basepairs of DNA in the haploid yeast genome. Express your answer inmillions of base pairs (Mb), a standard unit for expressing genomesize. Show your work. (b) How many base pairs per minute weresynthesized during the S phase of these yeast cells?arrow_forwardThe diploid human genome comprises 6,4 * 10^9 bp and fits into a nucleus that is 6 μm in diameter. If base pairs occur at intervals of 0.34 nm along the DNA helix, what is the length of DNA in a human cell If the diameter of the DNA helix is 2,4 nm, what fraction of the volume of the nucleus is occupied by DNA? [volume of a sphere is (4/3)πr^3 and volume of a cylinder is πr^2h]arrow_forward
- By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 = 2.44140625 => 2.4 For the above 10 kb DNA, if you use Sau3A to do a complete digestion, you will only get a lot of small fragments ( 200~500 base pairs). What should I do if I want to get larger digested fragments (say 3 to 5 kb) Please answer asap and type your answer and do not copy from anywhere pleasearrow_forwardThe Tm of a DNA strand can be calculated by hand using the formula: (2 ℃)(?????? ?? ? + ?) + (4 ℃)(?????? ?? ? + ?) = ??℃ Using this formular, calculate the Tm for the following DNA sequence: [CTTTCACAGCCACTATCCAGCGGTAC] Note: This formula has several limitations and is not useful for sequences longer than 14 bp. Use the Internet search to find an online Tm calculator. Use this calculator to find the Tm of the above sequence. Using information from your search, identify three factors that can affect the Tm.arrow_forwardRice genome contains 30% C on a molar basis. What are the mole percentages of A, G, and T?arrow_forward
- The human genome contains thousands of sequences known as small open reading frames, some of which encode proteins of about 30 amino acids. What is the minimum number of nucleotides required to encode such a protein?arrow_forwardWhat is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. Enter just the number, nothing else! Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro- A lilP mutant called lilPXS is isolated that produces a truncated polypeptide of only 6 AA in length. Describe a single basepair DNA change that would lead to this truncated version of the protein. Multiple options are possible (100 words max.)arrow_forwardA diploid human cell contains approximately 6.4 billion base pairs of DNA. a. How many nucleosomes are present in such a cell? (Assume that the linker DNA encompasses 40 bp.) b. How many histone proteins are complexed with this DNA?arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
- Biology: The Dynamic Science (MindTap Course List)BiologyISBN:9781305389892Author:Peter J. Russell, Paul E. Hertz, Beverly McMillanPublisher:Cengage Learning
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Cengage Learning
Genome Annotation, Sequence Conventions and Reading Frames; Author: Loren Launen;https://www.youtube.com/watch?v=MWvYgGyqVys;License: Standard Youtube License