Part A The bacterial gene little protein (lilP) makes a small protein of 11 animo acids (AA) in length. The DNA sequence of the lilP gene is shown below. 5'-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACTAGaaatattatttaa-3' 3'-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGATCtttataataaatt-3'
Q: "What are one of the main traits that make bacteria and archaea unique in comparison to protists,…
A: Bacteria and archaea are two domains of prokaryotic microorganisms that are among the most abundant…
Q: What types of species are more likely to undergo rapid evolutionary change, and what types of…
A: Introduction :- Evolution is the process of change in the inherited characteristics of species over…
Q: 1. Consider the following cross concerning 4 different gene loci: AaBbCcDd (x) AabbCcdd a. From this…
A: We are given genotype of two parents & we are to determine the genotype of certian genotypes. As…
Q: In order to be activated, the [Select] to bind to [Select] [ Select ] [ Select ] [Select] N…
A: Introduction Cell signaling, also known as signal transduction, is the process by which cells…
Q: Explain the outline below: Subviral agents: Viroids “viroid” for species “viroid” for genera…
A: The outline alludes to the viroids, which are subviral agents classified according to taxonomy.…
Q: What is the function of the corneal reflex? What is the function of the normal pupillary response to…
A: Introduction :- The corneal reflex is a protective reflex that involves the stimulation of the…
Q: What are 3 major functions of lipids in the body?
A: Lipids are organic substances with atoms of hydrogen, carbon, and oxygen that serve as the building…
Q: 12. The of is coupled to the of a. oxidation; NADH; synthesis; ATP; glycolysis b. reduction; NAD+;…
A: Oxidation is a chemical reaction in which a molecule loses electrons and becomes more positively…
Q: Part Three. Suppose you are a lab technician who is responsible for diagnostic analysis of…
A: A protein involved in a critical biological activity, such as DNA repair or cell division, that is…
Q: What is sustainability for you? Give 4 examples to differentiate between sustainable vs.…
A: Sustainability with context to biotechnology means that the products which are economical, social…
Q: Give written answer with explanation and conclusion With respect to nucleic acids (a) what is…
A: A mutation is a genetic alteration in the DNA sequence of an organism. Errors in DNA replication,…
Q: Mentions topics related to zootechnics
A: Zootechnics, also known as animal science or animal husbandry, is a branch of agriculture that…
Q: Which of the following was NOT one of the primary criteria for the mechanism to pass on traits…
A: ANSWER) To promote the passing of a particular trait mechanism from one generation to the next there…
Q: 10. What is a similarity between artificial insemination and in vitro fertilization (IVF)? The…
A: Introduction :- Fertilization is the process by which a sperm cell fuses with an egg cell to form a…
Q: What is the incidence, prevalence, and mortality rate with chickenpox?
A: Varicella, also known as chickenpox, is a very contagious viral infection. The result is an itchy…
Q: An E. coli culture that is fermenting glucose will grow faster when NO3 is added to the culture.…
A: Metabolism refers to the set of chemical reactions that occur in living organisms to maintain life.…
Q: Exercise 3. Complete the table with the ways of CHD using and drugs obtained from it. CHD Polygonum…
A: Plant identification is required in the analysis of herbal medicines and natural products because a…
Q: Consider the cross between a male with genotype AaBbCc and a female with genotype AaBBcc, where A is…
A: Genetics helps us understand how traits pass to progeny and it also helps to understand the…
Q: Complete the following statements by selecting one of the options provided. A mutation that…
A: The series of events that take place in a cell to divide it into two daughter cells is known as cell…
Q: Due to the redundancy of the genetic code small mutations can occur without having any effect on the…
A: ANSWER) The reductancy in the genetic code small mutations can result without affecting the proteins…
Q: Honorlock ASUO Zoom Chist Exam in Progress [Select] [Select] 14 Motocy ONA RAPID DEUSION OF HO…
A: Nitric oxide (NO) is a potent smooth muscle relaxant or vadodilator in blood vessels. Hence it is…
Q: Which of the following structures or processes does NOT participate in peripheral chemoreception? O…
A: Introduction :- Peripheral chemoreception is the process by which specialized cells in the body,…
Q: What is a cladogram? A cladogram is a diagram that shows relations among organisms. A cladogram uses…
A: Cladograms are branching structures that resemble trees and illustrate the shared links between two…
Q: What is the application of Gel Electrophoresis in healthcare? Cite at least 2 specific examples.
A: Gel Electrophoresis: A laboratory technique called gel electrophoresis is employed to divide…
Q: explain the relationship between predator and prey. Identify the patterns that exist in the dynamic…
A: Fundamental interactions in ecosystems involve predator prey relationships, in which one organism,…
Q: There are some exceptional free living organisms from the tree of life that lack rRNA O True False
A: Ribosomes are the primary component of the non-coding RNA known as ribosomal ribonucleic acid, are…
Q: What is the name for the step where RNA is created from a strip of DNA? Transcription Translation…
A: Introduction:- Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are most important molecules…
Q: Are there any nutritional risks vegetarians should be aware of?
A: Introduction :- Vegetarians are individuals who abstain from eating meat, poultry, and seafood, and…
Q: Phenylketonuria (PKU) is caused by the absence of the enzyme phenylalanine hydroxylase, which…
A: Phenylketonuria (PKU) is a genetic condition caused by a lack of the enzyme phenylalanine…
Q: Turner syndrome occurs when an individual inherits one X chromosome but lacks a second sex…
A: The question is asking which process (oogenesis or spermatogenesis) led to the nondisjunction event…
Q: Which of the following would be considered symbiotic interactions? Select all that apply Group of…
A: A symbiotic relationship is a long-term interaction between two or more different species, in which…
Q: You observe a flock of seagulls with 25 members. After performing a genetic analysis, you discover…
A: Introduction :- Homozygous dominant refers to an individual who has inherited two copies of the same…
Q: RNA strands are typically single stranded, and are shorter in length than DNA. True False
A: Introduction: Nucleic acids are vast, intricate molecules that are essential for the storage,…
Q: If the sequence of DNA on the template strand of a gene is AAA, the mRNA codon produced by…
A: Introduction: The genetic code is the set of rules that governs the relationship between the…
Q: In rats, the following genotypes of two independently assorting autosomal genes determine coat…
A: A Punnett square is a visual tool used to predict the probability of different genotypes and…
Q: 3. This figure shows different mutations discovered in the ß gene. A nucleotide substitution in the…
A: There are two types of thalassemia: beta and alpha. The three types of beta thalassemia are major…
Q: Describe neuronal transmission across two neurons.
A: Introduction :- Neuronal transmission refers to the process of communication between two neurons in…
Q: The following eukaryotic DNA is transcribed into RNA and the mRNA transcript is translated into…
A: mRNA: Messenger RNA (mRNA) is a type of RNA molecule that carries genetic information from the DNA…
Q: the group of lipids that contains amphipathic molecules are a. phospholipids b. triglycerides c.…
A: Amphipathic molecules are molecules that have both hydrophobic (water-repelling) and hydrophilic…
Q: When doing direct fecal smears, what is the difference between NSS from iodine in terms of usage and…
A: The identification of parasites includes determining the presence and type of parasite in a host…
Q: Discuss why Nancy might or might not want to know the results of her blood test for CF. 4. Should…
A: Cystic Fibrosis: Cystic Fibrosis (CF) is a genetic disorder that affects the respiratory, digestive,…
Q: D. If a phenotypic female does not have a Barr body, then what does this tell you about her…
A: Introduction Embryonic development refers to the process by which a fertilized egg develops into a…
Q: Dopamine drip ordered to run at 4MCG/KG/MIN dopamine bag has a concentration of 400 MG/250 ML. PT…
A:
Q: In RNA, uracil binds to adenine. O True O False
A: RNA full form Ribonucleic acids are mostly single stranded nucleic acids. These play an important…
Q: A man with Type A blood mates with a woman who has Type B blood. Which of the following progeny is…
A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous…
Q: Mi Chytridiomycota Ⓒ 1999 Addison Wesley Longman, Inc. Zygomycota zygomycota ascomycota Which is…
A: Basidiomycota is a phylum of fungi that includes the mushrooms, puffballs, and bracket fungi. They…
Q: Pleas write an essay on diabetes and endocrine diseases some conditions and teatment.
A: Many diseases can be challenging to diagnose or treat and may require specialized medical care. This…
Q: State and explain the virus family and their subfamilies especialliy those that have suffix of "ae".
A: Introduction :- Viruses are infectious agents that are not classified as living organisms because…
Q: The genetic difference within or between populations in the gene pool and/or gene frequency is…
A: Gene Pool: It refers to combination of all the genes including all type of alleles present in…
Q: A woman with type A blood has a child with a man with type AB blood. Show ALL the possible crosses…
A: The presence or absence of antigens on the surface of red blood cells determines blood type. The…
Step by step
Solved in 3 steps
- The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt-5’ Answer the following questions: Q1. Which is the coding strand? Which is the template strand? [10%] Top-bottom. Bottom-Top. Both can be used as either coding or template for this gene.The bacterial gene shorty (sh) encodes for a small protein. The DNA sequence of the sh gene is shown below. The ORF is in CAPITAL LETTERS 5’-tataatgggcttaacaATGAGTAAAAGAGGTCCTTTACTCCGGTATCACCAATAGaaatattatttaa-3’ 3’-atattacccgaattgtTACTCATTTTCTCCAGGAAATGAGGCCATAGTGGTTATCtttataataaatt What is the length in AA’s of the Sh protein? Assume fMet is NOT CLEAVED [10%] 39 AA 13 AA 12 AA 21 AAThis is part of the Escherichia coli DNA sequence that contains an inverted repeat. (Note: top strand is the coding strand). 5'-AACGCATGAGAAAGCCCCCCGGAAGATCACCTTCCGGGGGCTTTATATAATTAGC-3' 3'-TTGCGTACTCTTTCGGGGGGCCTTCTAGTGGAAGGCCCCCGAAATATATTAATCG-5' (i) Draw the structure of hairpin loop that will be formed during the end of transcription. (ii) Describe the function of the hairpin loop during transcription.
- Based on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGG3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…Figure 1 is a bacterial gene (1-180). The first base to be transcribed is the base located at position 77. 45 5' TTGGT CTTGG TCGGA TTCCA GAGGA TGAAG TGTTG ACAGC GCATT 3' 3 AACCA GAACC AGCCT AAGGT CTCCT ACTTC ACAAC TGTCG CGTAA 5' 46 5 AATTG ACCTT GCTGT ATTAT AGCCA AGGAC AGATC TACGA GCATG 3' 3 TTAAC TGGAA CGACA TAATA TCGGT TCCTG TCTAG ATGCT CGTAC 5' 91 5 TGCGA ACCGC AAGCA TTCGT TCTCC TAGGC TACTC GATCC CGTAA 3' 3 ACGCT TGGCG TTCGT AACCA AGAGG ATCCG ATGAG CTAGG GCATT 5 77 90 110 135 136 5 TGATG TAGCT GATTC TGTTG AAAGG CTCCT TTTGG AGCCT TTTTT 3 3' ACTAC ATCGA CTAAG ACAAC TTTCC GAGGA AAACC TCGGA AAAAA 5 156 180 Figure 1. Illustrate how termination of transcription occurs in the gene above. (Hint: position from 156 to 180)
- what is the anticodon sequence that would build this protein? AUGUUUGUACAUUUGUGUGGGAGUCACCUGGUUGAGGCGUUGUAUUUGGUUUGUGGCGAGCGCUUUUACCAGUUAGAGAAUUACUGATranscribe the following DNA sequence into RNA, and then into amino acids 5’-GTATACTTGTGGGCCAGGGCATTAGCCACACCAGCCACCACTTTCGGATCGGCAGCC-3’ 3’-CATATGAACACCCGGTCCCGTAATCGGTGTGGTCGGTGGTGAAAGCCTAGCCGTCGG-5’What is the sequence of the mRNA transcript that will be produced from the following sequence of DNA? The top strand is the template strand, the bottom strand is the coding strand. 5’ – TCGGGATTAGACGCACGTTGGCATACCTCG – 3’ 3’ – AGCCCTAATCTGCGTGCAACCGTATGGAGC – 5’ Enter the mRNA sequence here (pay close attention to the direction of the molecule!): 5'-_____-3'
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 1317) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80What’s the resulting amino acid sequence? 3’CAG TTA AGC CTC GGT TAC CAG GAT ACG GGA 5’