Microbiology: An Evolving Science (Fourth Edition)
4th Edition
ISBN: 9780393615098
Author: John W. Foster, Joan L. Slonczewski
Publisher: W. W. Norton & Company
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Question
Chapter 10, Problem 1TQ
Summary Introduction
To review:
The expression of the tryptophan operon after replacing the key tryptophan codons in the attenuator region with tyrosine codons.
Introduction:
Tryptophan (Trp) operon is a group of genes that encode for amino acid tryptophan. It is present in certain bacterial cells. Attenuation is the process of stopping transcription prematurely. During attenuation, transcription and translation occur simultaneously. It comprises an attenuator which is a signal present in the DNA (deoxyribonucleic acid) region near the leader sequence.
Expert Solution & Answer
Want to see the full answer?
Check out a sample textbook solution
Students have asked these similar questions
How will transcription of the E. coli trp (tryptophan) operon be affected by the following manipulations of the leader region of the trp mRNA?(a) Increasing the distance (number of bases) between the leader peptide gene and region 2(b) Increasing the distance between region 2 and region 3(c) Removing region 4(d) Changing several nucleotides in region 3 so that in can base pair with region 4 but not with region 2
What would happen to the regulation of the tryptophan operon in bacterial cells that express a mutant form of the tryptophan repressor that (1) cannot bind to DNA, (2) cannot bind tryptophan, or (3) binds to DNA even in the absence of tryptophan?
The lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a
single polycistronic mRNA. You are given a new strain of Escherichia coli with the following
lac operon genotype:
p+0°Z•Y*A +// P*O*Z*Y+ A-
(i)
Explain how the lac I gene affects gene expression.
(ii)
Explain the function of the lacP in the bacterial operon.
(iii)
Which part of the lac operon is cis-dominant? Explain.
Chapter 10 Solutions
Microbiology: An Evolving Science (Fourth Edition)
Ch. 10.1 - Prob. 1TQCh. 10.2 - Prob. 1TQCh. 10.2 - Prob. 2TQCh. 10.2 - Prob. 3TQCh. 10.2 - Prob. 4TQCh. 10.2 - Prob. 5TQCh. 10.3 - Prob. 1TQCh. 10.3 - Prob. 2TQCh. 10.4 - Prob. 1TQCh. 10.5 - Prob. 1TQ
Ch. 10.5 - Prob. 2TQCh. 10.6 - Prob. 1TQCh. 10 - Prob. 1RQCh. 10 - Prob. 2RQCh. 10 - Prob. 3RQCh. 10 - Prob. 4RQCh. 10 - Prob. 5RQCh. 10 - Prob. 6RQCh. 10 - Prob. 7RQCh. 10 - Prob. 8RQCh. 10 - Prob. 9RQCh. 10 - Prob. 10RQCh. 10 - Prob. 11RQCh. 10 - Prob. 12RQCh. 10 - Prob. 13RQCh. 10 - Prob. 14RQCh. 10 - Prob. 1TQCh. 10 - Prob. 2TQCh. 10 - Prob. 3TQCh. 10 - Prob. 4TQ
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- The following is a sequence of the leader region ofthe his operon mRNA in Salmonella typhimurium.What bases in this sequence could cause a ribosometo pause when histidine is limiting (that is, when thereis very little of it) in the medium?5′ AUGACACGCGUUCAAUUUAAACACCACCAUCAUCACCAUCAUCCUGACUAGUCUUUCAGGC 3′arrow_forwardGene expression in bacteria is controlled by the operon model. a) Why is the operon model important? b) Why is the trp operon known as a repressible operon?arrow_forwardThe lac operon consists of three structural genes, lacZ, lacY and lacA that are transcribed as a single polycistronic mRNA. You are given a new strain of Escherichia coli with the following lac operon genotype: p+0°Z•Y*A +// P*O*Z*Y+ A- (i) Explain how the lac I ³ gene affects gene expression.arrow_forward
- As diagrammed below, some amino acid biosynthetic operons have stem loop structures in the mRNA. These structures play a role in the regulation of the operon by which of the following mechanisms? Translation stop codon- Attenuator loop. mRNA 5' 3' DNA attenuator trpE O Catabolite repressor protein can bind and prevent the hairpins from forming thus allowing translation to occur. O The leader sequence shown contains codons for the amino acid. When these are low, the ribosome stalls, allowing a hairpin between the two middle regions to form so that the rest of the message can be translated. In the presence of large amounts of the amino acid, the hairpin will wind around the amino acid and prevent further translation. O A repressor protein made of that amino acid will bind to the region and prevent translation when large amounts of the amino acid are present. O The uridine-rich region has codons for that amino acid; when present, this region will be a terminator region. The hairpins allow…arrow_forwardWhat does the lac operon consist of? How is the operator switch turned on and off in the expression of genes in this operon? Explain.arrow_forwardThe attenuation mechanism that helps block expression of the tryptophan operon requires all of the following, except A) O MRNA transcript of the trp leader sequence B) Oaribosome stalled at the stop codon of the trp leader transcript C) O formation of an attenuator loop D) O low intracellular levels of tryptophanarrow_forward
- The transcription of many bacterial genes relies on functional groups called operons, such as the tryptophan operon. What is an operon?arrow_forwardWhat would happen if the operator sequence of the lac operon contained a mutation that prevented the repressor protein from binding the operator? (Explain what would happen both in the presence and absence of lactose)arrow_forwardUnder low tryptophanyl-tRNA (tRNAtrp), we expect the trp operon to be expressed because: Question 13 options: Sections 1 and 2 of the leader form a hairpin that acts as a transcriptional terminator. Sections 2 and 3 of the leader form a hairpin that prevents the formation of a transcriptional terminator. Sections 1 and 2 of the leader form a hairpin that prevents the formation of a transcriptional terminator. Sections 2 and 3 of the leader form a hairpin that acts as a transcriptional terminator. Sections 3 and 4 of the leader form a hairpin that acts as a transcriptional terminator.arrow_forward
- You have created a null mutation of tRNA synthase for trp-tRNA (the synthase enzyme attaches the trp amino acid to the tRNA which is necessary for translation or trp codons). If grown in high tryptophan conditions, what would be the effect of this mutation on protein levels of trpe (the first ORF after the leader region in the trp operon) relative to a wild-type strain grown under similar conditions? Increased trpE protein O No effect Decreased trpE proteinarrow_forwardThe trp operon in E. coli encodes enzymes essential for the biosynthesis of tryptophan. In the operon, trpR gene encodes the repressor. A trpR repressor cannot bind tryptophan. The trpO is the operator. trpA encodes the enzyme tryptophan synthetase. For the enzyme (A), indicate with a + or-whether or not it is made when there is tryptophan and when there is no tryptophan. Without Tryptophan With Tryptophan R'O A /R* O' A R'O' A/R* Oʻ A R*OA/R' O Aarrow_forwardWhat is the phenotype of an E. coli strain with a mutation in the lac operator that allows the lac repressor to irreversibly bind the operator? Assume glucose is absent. 1S A) O Transcription of the operon is very high whether lactose is present or not. B) O Transcription of the operon is very low whether lactose is present or not. C) O Transcription of the operon is high in the presence of lactose, and low in its absence. D) O Transcription of the operon is low in the presence of lactose, and high in its absence.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Human Anatomy & Physiology (11th Edition)BiologyISBN:9780134580999Author:Elaine N. Marieb, Katja N. HoehnPublisher:PEARSON
Biology 2eBiologyISBN:9781947172517Author:Matthew Douglas, Jung Choi, Mary Ann ClarkPublisher:OpenStax
Anatomy & PhysiologyBiologyISBN:9781259398629Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa StouterPublisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)BiologyISBN:9780815344322Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter WalterPublisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & PhysiologyBiologyISBN:9781260159363Author:Martin, Terry R., Prentice-craver, CynthiaPublisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)BiologyISBN:9781260231700Author:Sylvia S. Mader, Michael WindelspechtPublisher:McGraw Hill Education
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
Bacterial Genomics and Metagenomics; Author: Quadram Institute;https://www.youtube.com/watch?v=_6IdVTAFXoU;License: Standard youtube license