. One way to determine where inside a cell a protein(protein X) normally localizes is to generate a reportergene construct containing: (i) the gene X regulatoryregion and coding sequences, and (ii) coding sequencesfor GFP fused in frame to the 3′ end of the gene Xcoding sequences just before the stop codon. A mousecontaining such a transgene will express a hybrid protein X-GFP only in those cells in which gene X is normally expressed.a. The gene X-GFP fusion gene described could begenerated by knocking in GFP coding sequencesinstead of by random insertion of a transgene.Diagram the knockin construct you could use forthis purpose.b. What might the advantage be of the knockin strategy versus the transgene strategy?

. One way to determine where inside a cell a protein(protein X) normally localizes is to generate a reportergene construct containing: (i) the gene X regulatoryregion and coding sequences, and (ii) coding sequencesfor GFP fused in frame to the 3′ end of the gene Xcoding sequences just before the stop codon. A mousecontaining such a transgene will express a hybrid protein X-GFP only in those cells in which gene X is normally expressed.a. The gene X-GFP fusion gene described could begenerated by knocking in GFP coding sequencesinstead of by random insertion of a transgene.Diagram the knockin construct you could use forthis purpose.b. What might the advantage be of the knockin strategy versus the transgene strategy?

Name: . One way to determine where inside a cell a protein(protein X) normal
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: . One way to determine where inside a cell a protein(protein X) normally localizes is to generate a reportergene construct containing: (i) the gene X regulatoryregion and coding sequences, and (ii) coding sequencesfor GFP fused in frame to the 3′ end

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter15: Genomes And Genomics

Section: Chapter Questions

Problem 13QP

See similar textbooks

Similar questions

5 5 S 6 5 5 5 6 U 6 U 6 5:14 PM | 0.2KB/s HHHHH R R U RUUR ARU AP AP R U U R R AP R R R AP MOLECULAR...GENETICS. Describe gene regulation at transcription level. Explain the role of antsense RNA in control mechanism. Describe translational control mechanisms. Describe common DNA damages. Distinguish excision and mismatch repair. Describe the role of recA protein in recombination repair Elaborate on SOS repair mechanism. Define thymine dimer. How are they formed and repaired? Describe the molecular basis of mutation. 11 Leu+ Met+ Arg+ Write a detailed note on spontaneous mutation. Explain about mutant detection methods. Define reverse mutation. Describe the mechanism underlying Intragenic and intergenic suppressor mutations Describe the transposition mechanisms. 13 Vo LTE UNIT IV Time (Min) Describe the process of generalised transformation occurring in bacterial chromosome and plasmid. Elaborate on molecular mechanism and significance of transformation 22 Describe the process of…
Mutant # Deletion Region %Transcription (lungs) %Transcription(kidneys) WT None 100% 100% 1 1-200 130% 130% 2 250-400 100% 100% 3 500-800 50% 50% 4 950-1100 0% 100% 1) For the following gene, you notice the following results when analyzing several muntants. What type of sequence (be specific) has been mutated in mutant 1? What type of sequence (be specific) has been mutated in mutant 3? What would we call this type of mutation? What type of sequence (be specific) has been mutated in mutant 4?
Describe the 4 types of suppressor high copy suppression, bypass suppression, nonsense suppression, protein interaction . in your Own words. Often geneticists look for suppressors to find interactive proteins. Which of the type(s) of suppressors you put for part a will help to identify interacting proteins, and which type(s) will not? What are two (or one, if we don’t get a chance to talk about two of them in class) other techniques (not necessarily “genetic” techniques, but at least, lab techniques) that help to identify identifying proteins?
Trinucleotide repeat expansions (TNREs) are associated with severaldifferent human inherited diseases. Certain types of TNREsproduce a long stretch of the amino acid glutamine within theencoded protein. When a TNRE exerts its detrimental effect byproducing a glutamine stretch, are the following statements true orfalse?A. The TNRE is within the coding sequence of the gene.B. The TNRE prevents RNA polymerase from transcribing thegene properly.C. The trinucleotide sequence is CAG.D. The trinucleotide sequence is CCG.
In the module, you have learned about P-element mediated transgenesis in Drosophila and the concept of using transgenes to rescue mutant phenotypes. In the figure below, you will see a wild type fly with its natural eye colour and three mutants with their eye colours changed to vermillion, white and rosy, respectively. A schematic of P-element mediated transgenesis (as shown in the lectures) is also included in the figure. Please inspect the schematic carefully and choose which of the following statements is true: I. Injection of the white experimental transgene into the vermillion mutant embryo will not change the vermillion mutant phenotype II. Injection of the white experimental transgene in the rosy mutant embryo will change rosy eye colour to red (wild type) III. Injection of the white experimental transgene in the white mutant embryo will not change the white mutant phenotype IV. Injection of the white experimental transgene in the rosy mutant…
. One mechanism by which antisense RNAs act as negative regulators of gene expression is by base pairingwith the ribosome binding site on the sense mRNA toblock translation. In a second, alternative mechanism,the act of transcribing an antisense RNA can somehow prevent RNA polymerase from recognizing thesense promoter for the same gene. Design an experimental approach that would enable you to distinguishbetween these two modes of action at a specific gene.(Hint: What would be the outcome in each case ifhigh levels of the antisense RNA were transcribedfrom a gene on a plasmid?)
. The tac promoter, an artificial promoter made from a chemically syn- thesized oligonucleotide, has been introduced into a plasmid. It is a hybrid of the lac and trp promoters, containing the – 35 region of one and the – 10 region of the other. This promoter directs transcription initiation more efficiently than either the trp or lac promoters. Why?
(11) If you design a gRNA with the sequence, GGU AUC AUU GCA CUG ACC AG, in theory which position of the nucleotide in the genomic DNA sequence below will be cut by Cas9 protein, which may lead to a knockout due to an error in DNA repair? The starting and the end coordinate positions of the DNA fragment on the chromosome are indicated at the beginning and end of the sequence, respectively. 110,001 ATC GGT ATC ATT GCA CTG ACC AGA GGC TAC 110,030 A) Between 110,023 (G) and 110,024 (A) B) Between 110,021 (C) and 110,022 (A) C) Between 110,020 (C) and 110,021 (C) D) Between 110,009 (C) and 110,010 (A)
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA
(c) By binding one L-tryptophan molecule/monomer, the trp repressor binds to DNA to suppress syn- thesis of L-tryptophan in E. coli. Below is the amino acid sequence of the helix – (reverse) turn – helix region of the trp repressor that binds to DNA compared to the sequence of the corresponding DNA binding motif of the Prl protein, a different type of repressor protein. A diagram of the trp repressor dimer is also shown. reverse turn trp helix 4 70 Trp -Gly-Glu-Met-Ser-Gln-Arg-Glu-Leu-Lys-Asn-Glu-Leu-Gly-Ala-Gly- Ile- Prl -Ser-Glu-Glu-Ala-Lys-Glu-Glu-Leu-Ala-Lys-Lys-Cys-Gly-Ile-Thr- Val- Pri heilix trp helix 5 80 90 Trp Ala-Thr-Ile-Thr-Arg-Gly-Ser sgn-Ser-Leu-Lys-Ala-Ala- Prl Ser-Gln-Val-Ser-Asn-Trp-Phe-Gly-Asn-Lys-Arg-Ile-Arg- Prl helix
MCAD deficiency is an inborn error of metabolism. The coding strand is shown for the wild-type gene. The TATA box and kozak sequences are shown in parenthesis. Wild-type: 5’-ATGGCC[TATAT]ATGTCACTTGACTACGCAGCC[GCCACCATGG]ATATAGATAATGCGCGCATAGCATACTGAGGGTAGTAG-3’ What is the resulting polypeptide from the wild-type protein?
Which set of fragment ions is likely from the same population of precursors ions (parent peptide) from Covid-19 spike protein? b ion NFYEPQI+ and y ion +EPQIITTDK b ion VNNTVYDIP+ and y ion +NNTVYD b ion PLSETK+ and y ion +ALDP All of the described choices are likely. None of the described choices are likely.