Why would it be impossible for DNA splicing to occur utilizingthe same mechanism as eukaryotic MRNA splicing?Spliced DNA could not be transcribed or translatedDNA does not have a 3'-OH group for the initial nucleophilic attackthat forms the lariatO DNA does not encode intronsO DNA does not have a 2'-OH group for the initial nucleophilic attackthat forms the lariat

Name: Why would it be impossible for DNA splicing to occur utilizingthe sam
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Why would it be impossible for DNA splicing to occur utilizingthe same mechanism as eukaryotic MRNA splicing?Spliced DNA could not be transcribed or translatedDNA does not have a 3'-OH group for the initial nucleophilic attackthat forms the lariatO

RNA splicing is a kind of RNA processing in which a newly made precursor-mRNA is transformed into a…

Science

Biology

Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated O DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariat

Why would it be impossible for DNA splicing to occur utilizing the same mechanism as eukaryotic MRNA splicing? Spliced DNA could not be transcribed or translated O DNA does not have a 3'-OH group for the initial nucleophilic attack that forms the lariat DNA does not encode introns O DNA does not have a 2'-OH group for the initial nucleophilic attack that forms the lariat

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 22P

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Provide the complementary strand and the RNA transcription product for the following DNA template segment:5'-AGGGGCCGTTATCGTT-3'
The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'
Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'
Asap
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG CAT CCT CCC TCC TTT CTT TAA TAT TGG-3' 3'-GAA AGG GTA GTG GCG TAC GTA GGA GGG ACC AAA GAA ATT ATA ACC-5' Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’ direction. (1) Use the table and write the sequence of the resulting peptide. (1) Is it possible for a codon to code for another amino acid? (1) What will be the effect if a mutation changes the codon UAU to UAA? (1) What is a reading frame? (1) If you are given a nucleotide sequence, how would you find Open Reading Frames? (1) DISCUSS the reason why there are leading and lagging strands in replication?
3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ Make vertical lines between codons to make this assignment easier to do. Which strand is the template strand? The first strand is the template strand as it going 3-5 Copy the template strand in mRNA. Label the 5’ and 3’ ends. 5' AUG UUA CCC GCU GCG CGA AGC AAA GUC UAA 3” Write out the amino acid (you can use the short form) that this protein would be made of (keep in mind proteins are usually a minimum of 50 proteins. Met-Leu-Pro-Ala-Ala-Arg-Ser-Lys-Val What do you notice about the mRNA strand compared to the non template strand of DNA? 2. What amino acid does the second codon code for on the DNA template strand? ______Assume the 6th amino acid in the strand is changed from a T to a C. What amino acid does it code for now? _______ What type of mutation is this? 3. Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would…
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter U A G Letter phenylalanine serine tyrosine cysteine U phenylalanine serine tyrosine cysteine U leucine serine stop stop A tryptophan arginine arginine leucine serine stop leucine proline histidine U leucine proline histidine leucine proline glutamine arginine A leucine proline glutamine arginine G isoleucine threonine asparagine serine U isoleucine threonine asparagine serine A isoleucine threonine lysine arginine A methionine threonine lysine arginine G valine alanine aspartate glycine U valine alanine aspartate glycine G valine alanine glutamate glycine A valine alanine glutamate glycine G O Met-lle-Thr-Ala-STOP O Met-Ser-Thr-Ala-STOP Met-Ser-Trp-Arg-STOP Met-Tyr-Thr-Arg-STOP
The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'
What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’