The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'

The following segment of DNA is part of the RNA-coding sequence of a transcription unit. If the bottom strand is template, which of the following RNA sequences would be transcribed? DNA: 5-'ATAGGCGATGCCA-3' 3'-TATCCGCTACGGT-5' O 5'-UAUCCGCUACGGU-3' O 5'-ACCGUAGCGGAUA-3' O 5'-AUAGGCGAUGCCA-3' O 5'-UGGCAUCGCCUAU-3'

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’ 5’-TCCAGGTCAGAAGCCGCCTACTAGCCCGGTTGGGGGCATTGACCAGTGGCCTTACGG -3’ , while using the bottom strand is the template for transcription. If the START CODON is AUG and the STOP CODON IS UGA, how many amino acids are in the encoded protein and what is the primary structure?
For this double stranded DNA: 3’-AGGTCCAGTCTTCGGCGGATGATCGGGCCAACCCCCGTAACTGGTCACCGGAATGCC-5’ 5’-TCCAGGTCAGAAGCCGCCTACTAGCCCGGTTGGGGGCATTGACCAGTGGCCTTACGG -3’ , while using the bottom strand is the template for transcription. If the START CODON is AUG and the STOP CODON IS UGA, what would it look like drawn out?
What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide. 3’-ATGCCTACGGGTACGCCACTACTCCC-5’ 5’-TACCCATGCCCATGCGGTGATGAGGG-3’
Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and with the correct 5' and 3' ends. DNA: 5'-ATAGGGCATGT-3' 3'-TATCCCGTACA-5' <--- template strand Group of answer choices 5'-ATAGGGCATGT-3' 3'-UAUCCCGUACA-5' 5'-AUAGGGCAUGU-3' 3'-TATCCCGTACA-5'
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’- ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’(a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect?
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5'-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3' 3'-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5' (a) Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the MRNA derived from this fragment? (b) Find the initiation and stop codons in this mRNA. (c) Would there be an effect on translation of changing the fourth T in the template strand to a C? If so, what effect? (d) Would there be an effect on translation of changing the fourth A in the template strand to a C? If so, what effect? AGA UUA UUG CUA AUA CUC GCA CGA GUA GUC ACA UAA UAG UGA UUC CCG ACG GCU CGU GAU AAU UGU GAG CAG GGU CAU AUU CUU AAG AUG UUU CCU UCU ACU UGG UAU GUU Ala Arg Asp Asn Cys Glu Gin Gly His le Leu Lys Met Phe Pro Ser The Trp Tyr Val stop DNCE M FP HIL
Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-ATGCTGCGTGCATGGGATATAGGTAGCACACGTCC-3’ 3’-TACGACGCACGTACCC TATATCC ATCGTGTGCAGG-5’ Assuming that transcription starts with the first C in the template strand, and continues to the end, what would be the sequence of the mRNA derived from this fragment? Q) Would there be an effect on translation of changing the fourthT in the template strand to a C? If so, what effect?
If the following piece of DNA were used as a template for transcription, what would the sequence of the new RNA strand be? Template: 5'-GACATAGAA-3' 5'-UUCUAUGUC-3' 5-TTСТАТGTС-3' 5'-CUGUAUCUU-3' 5-СTGTATСTT-3
The following DNA strand is a template strand (also called non-coding strand) of an E. coli gene. Arrow indicates the direction of transcription. The asterisk indicates t transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' GCAGTGA 3' -10 Which of the following sequences accurately represents the RNA derived from this gene? C5' UCCUUAC 3' C3' UCCUUAC 5' C5' CGUCACU 3' +10 3' AGGAATG 5'