What polypeptide would be produced from the following strand of DNA? The first pair of nucleotides (bolded) contains the start point of transcription. Label the C-terminus and N-terminus ends of the polypeptide.   3’-ATGCCTACGGGTACGCCACTACTCCC-5’   5’-TACCCATGCCCATGCGGTGATGAGGG-3’

Give the sequence of the LEFT (5'-end) region of this RNA strand that would participate in forming the stem of a stem-loop with this bit of RNA. DRAW this stem-loop in your scratch work!     5’-UGGUGGAUCUCUGCAACUGAUCCAUUG-3’

The following DNA strand is a template strand (also called non-coding strand) of an E. coli gene. Arrow indicates the direction of transcription. The asterisk indicates t transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' GCAGTGA 3' -10 Which of the following sequences accurately represents the RNA derived from this gene? C5' UCCUUAC 3' C3' UCCUUAC 5' C5' CGUCACU 3' +10 3' AGGAATG 5'

Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First Position