Shown here is a DNA sequence. The promoter is highlighted in yellow and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. The A marked with a star is replaced by a T. What kind of mutaiton is this? 5 -ATATTTGCTAGACTGTCGCTCCGATCTGTACTTGATGCGATTČGGATC GATGCGATTČGGATCCCCGCTCCGATCGTAGGAG TAGGAGATTGCTGTTTTAC-3' 3'-TATAAACGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATCCTCTAACGACAAAATG -5' Terminator Promoter O Silent O Missense O Nonsense O Frameshift

The following DNA strand is a template strand (also called non-coding strand) of an E. coli gene. Arrow indicates the direction of transcription. The asterisk indicates t transcription initiation site GCAGTGACCGGATATAACGAAGAGGAATGCCGTACAAA 5' GCAGTGA 3' -10 Which of the following sequences accurately represents the RNA derived from this gene? C5' UCCUUAC 3' C3' UCCUUAC 5' C5' CGUCACU 3' +10 3' AGGAATG 5'

The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.

17) Synthesis of the mRNA starts at the boxed A/T base pair indicated by the box and proceeds left to right on the sequence below. Transcribe and translate this bacterial gene. 5'-GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTIGICAGGTGGGATGACTTGGATGGAAAAGTAGAAGGTCATG-3 3'-CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC-5′ 1 -+--at - --+-- 80