**Question 4: DNA Sequence Analysis**Shown here is a DNA sequence. The promoter is highlighted in yellow, and the terminator is highlighted in blue. Transcription begins 10 bases from the promoter. The A marked with a star is replaced by a T. What kind of mutation is this?**DNA Sequence:****5’ - ATATTTGCTAGACTGT** CGCTCCGGATCTGTAGTCGTAGCTCGGATGCTGAGTAGCGTCCGCGTCTAACGTGCTTTTTAC - 3’ **3’ - TATAAACGATCTGACA** GCGAGGCCTAGACATCAGCATCGAGCCTACGACTCATCGCAGGCGCAGAATTGCACGAAAATG - 5’- **Promoter**: Highlighted in yellow- **Terminator**: Highlighted in blue**Mutation Question:**The A marked with a star (*) is replaced by a T. **Options for Mutation Type:**- Silent- Missense- Nonsense- Frameshift**Explanation:**- **Promoter Region**: The promoter is a sequence of DNA needed to turn a gene on or off. In this sequence, it is highlighted in yellow. - **Terminator Region**: The terminator is a sequence of DNA that signals the end of transcription. In this sequence, it is highlighted in blue.- **Mutation Analysis**: The mutation involves a substitution of adenine (A) by thymine (T) at the position marked by a star. This can be analyzed to determine the type of mutation it causes (silent, missense, nonsense, or frameshift).

Given: Sequence of template DNA is TATARACGATCTGACAGCGAGGCTAGACATGAACTACGCTAAGCCTAGGGGCGAGGCTAGCATCCTCTAACGACHARATG. Transcription begins 10 bases from the promoter. The A marked with a star is replaced by a T. Transcription would use the lower strand as the template strand and the RNA will be synthesized complimentary to that strand. If the transcription starts 10bp from the promotor, the codon with mutation would be the GCT which would change to the GCA codon. After transcription, the codon will be CGU. While the normal codon was supposed to be CGA Both CGA as well as CGU syntheses the amino acid arginine, therefore, the type of mutation would be considered as the silent mutation. All the other options are incorrect because missence and nonsense mutations both results in the change of amino acid sequence. Also, frameshift mutations occur when there is deletion or insertion of bases.