Q: Discuss the following: Lysogeny establishment in bacteriophage lambda Lysogeny mentainance in bacte...
A: This phenomena is first elaborated and explained by French biologist André Lwoff in the early 1950s....
Q: What causes the Wolffian duct to develop into male reproductive structures? This will happen in the ...
A: Introduction: The Wolffian tube is also known as mesonephric duct, Leydig's duct and nephric duct wh...
Q: 11.The critical decision point at which a cell determines its fate at the end of the G1 phase of the...
A: 11. ANSWER;- d).Restriction point. Explain;- The restriction point (R), otherwise called the Start ...
Q: Given an = 0.2 Gy-, Bn 0.08 Gy-1 for normal tissue and a,n = 0.5 Gy-1, Bn = 0.05 Gy-1 for tumor, cal...
A: Given, For normal tissue, alpha n = 0.2 Gy-1 and beta n = 0.08 Gy-1 For tumor, alpha n = 0.5 Gy-1 a...
Q: A virus has been identified that encodes a protein which inhibits the transporter-associated with an...
A: Transporter associated with antigen processing (TAP)
Q: Wildfire Specialist
A: A wildfire is an abnormal fire that burns in a natural area such as a forest grassland. Wildfires ar...
Q: What valuable information can an archaeologist gain from understanding the connections between long-...
A: Archeology gives us the chance to find about past culture through the investigation of artifacts, an...
Q: 41. The template strand of a gene has the sequence 3'-TCCCATGAG-5', Which of the following would be ...
A: Amino acids are the structural unit of proteins. there are majorly of 20 amino acids which are divid...
Q: What is the most likely fate(s) of sugar when consumed in coffee by a person who just finished a wor...
A: Glycogen is the major fuel source during heavy exercises . When a person does heavy workout all of t...
Q: Labelled primers or dNTPs are useful in some recombinant DNA techniques. What are DNA primers? What...
A: 1* DNA primers is a short and single stranded nucleic acid sequence that is the starting point for D...
Q: What best describes the hind leg bones seen in the whale? Leg bone O Vestigial structures that had a...
A: INTRODUCTION Vestigial structure This is anatomical structures which has no longer purpose in the cu...
Q: Differentiate between TWO of the following pairs: Genetic and a restriction map Southern and colon...
A: The mapping of DNA refers to the identification of the location of particular genes. Genetic map and...
Q: 41- Gamma motor neurons: a- Causes contraction of the equatorial region of an intrafusal fiber b- Ar...
A: The mechanism of gamma motor neurons helps in regulating muscle length and tone.
Q: a. What are the three categories of genes mutated in cancer cells? What is the effect of mutation of...
A: 1. a. What are the three categories of genes mutated in cancer cells? What is the effect of mutat...
Q: Which of the following would be classified as non-coding DNA? (mark all applicable answers) The cyto...
A: Non coding DNA are sequences of DNA that do not code for proteins.
Q: What body systems are affected by eubacterium?
A: The eubacteria are also known as true bacteria. They are unicellular prokaryotic organisms that have...
Q: Differentiate nuclear form extrachromosomal inheritance and solve problems illustrating the latter.
A: Inheritance is the transmission of characters from the parents to the offspring, i.e members of each...
Q: QUESTION 1 Tigers are much more complex organisms than the single-celled Amoeba dubia, however tiger...
A: The genome size doesn't directly proportional to complexity or body size of an organism.
Q: Which is required for a population to evolve?a. genetic diversity c. gene flowb. selection pressure ...
A: Evolutionary theory provides a unified framework to explain the similarities and differences among l...
Q: Which of the following organisms is an example of fungus-like protist? Group of answer choices water...
A: INTRODUCTION Fungus like protists Fungus like protists are protists that absorb food from dead organ...
Q: If a cell were to have an unusually large response to cortisol, what effect would you expect to see?...
A: *Cortisol is an glucocorticoid synthesized in the zona fasciculata of the adrenal cortex. *Cortiso...
Q: Explain how the cell uses glycogen as an energy source. Connect the use of glycogen for energy to th...
A: Glycogen is a large, branched polysaccharide that is the main storage form of glucose in animals and...
Q: The lowest level of stimulation that a person can consciously detect 50 percent of the time the stim...
A: Sensation is the process of transmitting information from sensory receptors to the brain, allowing a...
Q: What is the difference between sequential and concerted assembly? Herpes viruses sequential assembly...
A: Flu Viruses (Influenza) Flu infections have a place with the Orthomyxoviridae family and are named...
Q: A dog with brown fur breeds with a dog with gray fur. When the puppies are born, three of the puppie...
A: Consider, Brown fur colour is dominant trait and gray fur colour is recessive trait. Brown - BB Gray...
Q: What explanations can account for the following pedigree of a very rare trait? Be as specific as pos...
A: The pedigree analysis helps us identifying the mode of inheritance of a particular disease by observ...
Q: Construct your own graphic organizer or concept map that explains the occurrences of evolution.
A: Evolution is defined as the process by which the organisms change over time as a result of changes i...
Q: From the clinical evidence on brain injury, it appears that storage bins for long-term memories are ...
A: Long-term memory is the storage of information in the brain for a longer period of time (often for y...
Q: Which of the following processes includes the removal of introns in the primary RNA transcripts? Gro...
A: The process which is associated with removal of Introns in the primary RNA transcripts is SPLICING. ...
Q: Keep answers, short, simple, and concise. No detail required. Is ATP produced during the light ...
A: The photosynthesis is the process that involves production of carbohydrates (glucose) by using energ...
Q: Distinguish between taxonomy and phylogeny
A: *Taxonomy is the study of classification of organisms into taxa by arranging them in highly ordered ...
Q: Which point on the PV loop corresponds to the opening and closing, respectively of the aortic valve?...
A: Introduction : PV loop derived from pressure and volume data found from cardiac cycle. If left vent...
Q: Compare and contrast Organization of Genetic Material in prokaryotes and eukaryotes
A: Prokaryotes are unicellular organisms and eukaryotes are multicellular organisms. Prokaryotes lack m...
Q: Record the genotypes for pea plants with the following descriptions: A. A plant with yellow pods: B....
A: Genes determine traits such as color, shape, height, and each gene is governed by two alleles, each ...
Q: (a) Name the following : (1) The phenomenon by which living or dead plant cells absorb water by surf...
A: A cell is the smallest unit of life. It is divided into two types: prokaryotic and eukaryotic. A cel...
Q: - For the resting membrane potential: a- The inside is negative in comparison with the outside. b- N...
A: Resting membrane potential is the voltage across the plasma membrane before the actual action potent...
Q: What kind of weak bonds hold the two strands together? How is that weak bond drawn?
A: Answer - Hydrogen bonds (-H) is a weak bond that holds two strands together. Explanation - Each str...
Q: . You have identified a mutation in yeast, a unicellular eukaryote, that prevents the capping of the...
A: Central dogma states the conversion of DNA into mRNA via transcription and mRNA into proteins by tra...
Q: Meiosis: Sequence of Stages Number the stages of meiosis from 1 to 8 to show their correct chronolog...
A: Meiosis is a reductional division contains meiosis-I and II. In meiosis-I, the prophase-I is the lon...
Q: Which of the following segments of RNA are retained after conversion of a pre-mRNA to a mature mRNA?...
A: RNA: it is of different types such as rRNA, tRNA, mRNA etc.
Q: What is the scientific description of the fruit in this picture? What is the specific term or name f...
A: Plants kingdom is a diverse kingdom whi h comprises of autotrophic , photosynthetic organisms that i...
Q: 23- If the number of IPSPS on the membrane decreases while EPSPS remain the same: a- Triggering acti...
A: Excitatory Postsynaptic Potential (EPSP) is an excitatory charge on the postsynaptic membrane formed...
Q: Which technique used to manipulate genetic material results in a significant increase in DNA or RNA ...
A: In biotechnology laboratories different techniques are used to manipulate the genome of the organism...
Q: is the protein produced by S. aureus that causes od to release attractants. PLV kills which release ...
A: surface proteins that are covalently attached to peptidoglycan, which are known as cell wall-anchore...
Q: Which of the following is NOT true about viruses? O a. The vast majority cause severe disease of the...
A: Virus Viruses are non living particles when present out side the host cell and when enters/ infects...
Q: Describe the wood frog's adaptation which is the ability to freeze its body. Is this adaptation beha...
A: The wood frog possesses special distinct characteristics that gain the attention of biologist since ...
Q: Predict the transmission of phenotypes associated with maternal effect genes. 2. Interpret the resu...
A: Cytoplasmic inheritance, also known as extra nuclear inheritance, extra chromosomal inheritance, non...
Q: the protein you are making is one that is not destined to be secreted into the extracellular space, ...
A: In a eukaryotic cell, all protein translation begins in the cytoplasm (except for a few proteins mad...
Q: Coomassie dye is the equivalent of what component used in analysis of DNA by agarose gel electrophor...
A: Western blot helps to identify specific proteins from a mixture of proteins and this step follows af...
Q: Which of the following is NOT part of the endomembrane system? O chloroplast O plasma membrane Ovesi...
A: Introduction: A cell is the smallest unit of life which has a definite structure and a specific func...
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- The sequence of part of an mRNA transcript is What is the sequence of the DNA coding strand? 5'- 5' - AUGGGGAACAGCAAGAGUGGGGCCCUGUCCAAGGAG - 3' 5'- ATGGGGAACAGCAAGAGTGGGGCCCTGTCCAAGGAG What is the sequence of the DNA template strand? TACCCCTTGTCGTTCTCACCCCGGGACAGGTTCCTC Incorrect -3' -3'Given the following stretch of mRNA, what would be the sequence of the corresponding non-template DNA? 5' - UUG-CAA-UCG-CAG-UGC-CGC-AUA-GAU - 3' Group of answer choices 3' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 5' 5' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 3' 5' - AAC-GTT-AGC-GTC-ACG-GCG-TAT-CTA - 3' 3' - AAC-GUU-AGC-GUC-ACG-GCG-UAU-CUA - 5' 3' - TTG-CAA-TCG-CAG-TGC-CGC-ATA-GAT - 5'A protein uses a gene template in 3' to 5' direction. What are the amino acid sequences following this DNA chain? 5'-ATGTCGACAGCCTAA-3' First Second Letter Third Letter Letter phenylalanine phenylalanine serine tyrosine tyrosine cysteine cysteine U serine leucine serine stop stop A leucine serine stop tryptophan arginine G leucine proline histidine leucine proline histidine arginine leucine proline glutamine arginine arginine A leucine proline glutamine isoleucine threonine asparagine asparagine lysine serine isoleucine threonine serine A isoleucine threonine arginine methionine threonine lysine aspartate arginine valine alanine glycine glycine valine alanine aspartate C G valine alanine glutamate glycine glycine A valine alanine glutamate O Met-lle-Thr-Ala-STOP O Met-Ser-Trp-Arg-STOP O Met-Tyr-Thr-Arg-STOP O Met-Ser-Thr-Ala-STOP
- If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base A G UUU1 Phenylalanine UCUT UAUT FTyrosine (Tyr) UAC UGU, U FCysteine (Cys) UGCJ UUCJ (Phe) UCC Serine (Ser) UCA U UGA - Stop A UUA1 FLeucine (Leu) UUG- UAA1 FStop UAGJ UCG- UGG - Tryptophan (Trp) G CUU CAU1 CCU1 CGUT Histidine (His) CAC- CUC CCC Proline (Pro) CCA CGC FLeucine (Leu) CUA FArginine (Arg) CGA CAA1 Glutamine A CAGJ (Glu) CGG- CUG- CCG- ACU AAUJ Asparagine AUUT AGUT FSerine (Ser) AGC- U AUC FIsoleucine (lle) ACC AACJ(Asn) Threonine A AUA- (Thr) AAA1 FLysine (Lys) AAG- АСА AGA, FArginine (Arg) AGG- A Start Methionine AUG- (Met) ACG- G GUU GCU, GAU1 Aspartic Acid GGU U GAÇJ(Asp) GUC Fvaline (Val) GUA GCC GGC G Alanine (Ala) GCA Glycine (Gly) A GAAJ Glutamic Acid GGA GAG- (Glu) GUG- GCG- GGG- GThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter GlyGiven the following protein, which of the following sequences of TEMPLATE strand DNA would code for it? Pay attention to the polarity of the polypeptide and the strands of DNA that you choose. Use the codon chart to the right. AUG = met AAA = lys GCU = ala | CUU = leu ACU = thr -lys - thr - ala - leu - met (amino end) 5' TAC GAA CGA TGA TTT TAC ATT 3' 5' ATG CTT GCT ACT AAA ATG TAA 3' (carboxyl end) met 5' TAC TTT TGA CGA GAA TAC ATT 3¹' 3' TAC TTT TGA CGA GAA TAC ATT 5¹ 5' ATG AAA ACT GCT CTT ATG TAA 3¹ 3 TAC GAA CGA TGA TTT TAC ATT 5'
- Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’#4 BamI --- 5’ CCTAG ↓G 3’ 5’ ACGCCTAGGACGTATTATCCTAGGTAT CCGCCGCCGT CATCA 3’ 3’ TGCGGATCCTGCATAATAGGATCCATAGGCGGCGGCAGTAGT 5’ Restriction enzyme: Recognition sequence: Number of pieces of DNA: Type of cut:26. Using the following DNA strand, write out the mRNA, and then the amino acids. DNA: 3' T- A- C- A- A- G- T- A- C- T- T- G- T- T- T- C- T- T- A- A- A 5' A LIGUULAUGAOLAAAGAAUUL Phe- MRNA: Amino Acids: met Phe- met Asme -LyS- G la- 27. Suppose the two guanosine (G) nucleotides in3 above were changed to two cytosine (C) nucleotides. What is the new amino acid chain? 28. Suppose the two guanosine (G) nucleotides in #3 were removed from the DNA strand. How would this mutation affect the amino acid chain? Write out the new amino acid chain.
- Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? 3’-CATCGGAATAGATCGCTAGTGGCAGGCATAATGATCACCGGTCTGAGAAAAGTGGTACATATCAAC-5’Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'