Plasmid is  3.6kb large. It is digested with an enzyme that has restriction sites at  1,152 and 2,954. How many fragments do we have and what are their sizes?

Q: In several experiments, you find these orders of genes getting transferred in from the chromosome…

A: F plasmid is a type of plasmid which allows the transfer of genes from one bacteria to the other…

Q: Why do adult human cells (other than germ cells and stem cells) NOT express the enzyme telomerase?…

A: Telomerase expression is required for cell immortalization ( in cancer cells) and long term tumour…

Q: A virus with a circular double-stranded DNA chromosome contains approximately 10,000 bp. You want to…

A: To construct a map of the viral chromosome based on the cleavage sites of the restriction…

Q: You want to clone the Human Gene A into a plasmid for producing the Protein A in bacteria. GeneA…

A: Introduction :- A plasmid is a small, circular, double-stranded DNA molecule that is separate from…

Q: A shuttle vector is a vector (usually a plasmid) constructed so that it can propagate in two…

A: The episomal vectors are the plasmid constructions that replicate in both eukaryotic and prokaryotic…

Q: pXO1 and pXO2 are large plasmids – large pieces of DNA that are not the chromosome that can…

A: Plasmids are the extra chromosomal material which are present independently of  the main…

Q: You plan to clone exon 11 of the HEXA gene (Section C) into the multiple cloning site (MCS) of the…

A: Answer well explained above

Q: Draw a representative agarose gel showing the bands, and the direction of current flow as well point…

A: EcoR1 is a restriction enzyme that can cleave a dsDNA at the sequence GTTAAC. They cleave the cite…

Q: A circular plasmid of 10,000 base pairs (bp) is digested with two restriction enzymes, A and B, to…

A: in agarose gel electrophoresis we separate DNA bands based on their size.

Q: This is a restriction map for the 250 base pair plasmid pSage. Restriction sites for the restriction…

A: Restrictions endonucleases are enzymes that cut down the DNA into fragments near or at the site of…

Q: You digest a 5 kb plasmid with two enzymes that yield fragments of 4 kb and 1 kb. After running the…

A: Gel electrophoresis is a technique that separates DNA fragments based on their size. In this…

Q: When circular DNA is sequenced, the nucleotide base pairs are numbered starting from a fixed…

A: It is related to molecular biology in which we use restriction enzymes an important tool for

Q: Using the plasmid map attached and the answer from the previous question, draw a simplified diagram…

A: The image you provided shows a diagram of the YCplac33 plasmid. This plasmid is a commonly used…

Q: Now that you’ve isolated the gene and made lots of copies, you need to insert the gene into…

A: Plasmids are used in genetic engineering to increase the number of copies of a gene. A plasmid is a…

Q: Why is the presence of insertion sequences on the F plasmid significant? What are F- prime (or F')…

A: The process of fusion of two compatible bacterial cells, is known as Conjugation. It requires the…

Q: The telomeres of a linear chromosome are made of identical directly repeated DNA sequences. How does…

A: Telomeres:These are the special DNA caps in the eukaryotic chromosomes that prevent the loss of…

Q: 3000 bp 2000 bp 1000 bp 800 bp 700 bp 500 bp L Uncut EcoRI 1 BamHI Ncol EcoR1/BamH1 BamHI/Nco1…

A: Use the gel to answer the following questions. You will be constructing a map of the plasmid,…

Q: Kan selectable marker plant selectable marker constitutive promoter T-region conjugative transfer…

A: Agrobacterium tumefaciens is a soil bacterium that naturally infects plants and produces tumors by…

Q: a)Dr. Thisisaneasyexam decides to amplify a gene from a plasmid using PCR. She starts out with 6.6 x…

A: Sure, let me provide a more detailed explanation for the calculations.a) Calculating the number of…

Q: Restriction enzymes in bacterial cytoplasm cut injected bacteriophage DNA wherever certain sequences…

A: The genes are the hereditary unit of an organism. Specific nucleotide sequence of a gene causes the…

Q: QUESTION 24 Answer Assume that a given plasmid vector to be used in a cloning experiment contains…

A: Plasmid is a circular dna molecule used in cloning experiments. This is a small double stranded DNA…

Q: The genomic DNA of an organism has a base composition of 60% C-G base pairs and 40% A-T base pairs.…

A: DNA stands for deoxyribonucleic acid. It is a genetic material. It is present in the nucleus and…

Q: A plasmid DNA and a linear DNA (both of the same size) have one site for a restriction endonuclease.…

A: Because plasmid is a circular DNA molecule, this is the case. It becomes linear but not fragmented…

Q: When using the plasmid shown below for cloning, which restriction enzyme site(s) (all indicated with…

A: A plasmid is a double-stranded DNA molecule that is small and circular in shape.  Bactria and yeast…

Q: What is the direction of transcription in the plasmid shown below? Explain your answer based on the…

A: Transcription is the process of synthesis of RNA using DNA as the template and is catalyzed by

Q: Restriction enzymes come in a concentration of U/ml, and it is recommended that 1U be used for each…

A: Restriction enzymes (RE) are the enzymes that recognize and cut specific sequences of DNA called…

Q: complimentary sticky ends

A: DNA's are cut by using restriction enzymes ( endonuclease or exonuclease) which produce sticky or…

Q: The diagram below shows that of a plasmid containing genes that confers erythromycin (Erm®) and…

A: Plasmids are small circular double-stranded DNA molecules that store additional genetic information…

Q: When linear DNA is sequenced, the nucleotide base pairs are numbered from the start to finish. a DNA…

A: DNA is the genetic material present in all living cells. It carries information from one cell to…

Q: A. Use this data to generate a circular map of the plasmid. Pst I: 10 kb Bam HI: 10 kb Sal I:…

A: Restriction endonucleases are enzymes that cut DNA at specific sites. Restriction endonucleases…

Q: These are the results after running Agarose Gel Electrophoresis of the cut/uncut pUC19 plasmid and…

A: These are the results after running Agarose Gel Electrophoresis of the cut/uncut pUC19 plasmid and…

Q: A closed circular plasmid B-DNA (10.5 bp/turn) consists of 231 base pairs and has    Wr= -1…

A: DNA Supercoiling --DNA supercoiling refers to amount of twist in a particular DNA Strand, which…

Q: Calculate the linking number “L” for a 210 base pair closed circular plasmid with 4 negative…

A:

Q: In producing genetically engineered human insulin in bacteria, why is it important to use the…

A: Insulin is a natural peptide hormone produced by the beta cells of the pancreas in response to high…

Q: The sequence 5' GCCTAATGCGTTCATAATGGCGTTTGCCACGGACGTAAAGTCGT 3' represents 50% of a PCR product…

A: Agarose gel electrophoresis used to separate DNA according to its molecular weight. On agarose gel,…

Q: The genes for both the α- and βglobin chains of hemoglobin contain introns (i.e., they are split…

A: Introns are the non active genes present in the DNA.

Q: A shuttle vector is a vector (usually a plasmid) different host species. One of the most common…

A: Shuttle vector It refers to the type of vector, often a plasmid designed to spread among two…

Q: You want to digest 1 µg of plasmid DNA in a final volume of 50 µL. Your solution containing plasmid…

A: A plasmid is an extrachromosomal DNA molecule within a cell that is distinct from chromosomal DNA…

Q: between the two restriction sites, how would the banding pattern on the gel differ from the one you…

A: Restriction sites are the special palindromic sequences present in DNA. These sites are the location…

Q: To test patients for COVID19, lab workers will first convert all the RNA molecules extracted from a…

A: Replication:  DNA replication is the biological process of making two identical replicas of DNA from…