Match the following Conjugation terms with the most appropriate description in the image: F- recombinant F- strain F+ strain HFR strain

The answer bank only has one 9 minute option, therefore 9 minutes can only be used once. Is it possible that there is a mistake in the above solution?

You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined changes to to a C the result will be - A) A nonsenese mutation B) A frameshift mutation C) A silent substitution D) A missense mutation You have the following DNA sequence: 5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. If the G that is underlined is deleted, then the result will be A) A nonsense mutation B) A frameshift mutation C) A silent substitution D) A missense mutatio If there are 3000 bases in the coding region of a gene, the gene will have A) 3000 amino acids B) 6000 amino acids C) 1000 amino acids D) 3000 codons

Determine which primer pair is the best choice. Explain why the other primers are not good choices. Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best. Forward 1: Reverse 1: Forward 2: Reverse 2: Forward 3: Reverse 3: Forward 4: Reverse 4: Forward 5: Reverse 5: Forward 6: Reverse 6: Forward 7: Reverse 7: Forward 8: Reverse 8: Forward 9: Reverse 9: 5' gaaataattttgtttaactttaag 3' Tm= 5' gtttaagacaaaatagtctgg 3' Tm = 5' gtaactcagetttcaggtcg 3¹ 5' tctcggaatgttgcaacage 3¹ 5' agattageggatcctacctg 3' 5' atgtgtaatcccagcagcag 3¹ Tm= Tm= Tm= Tm = 5' cattgattatttgcacggcg 3' Tm= 5' aaaatettctctcatccgcc 3' Tm= 5' tccataagattagcggatce 3' Tm= 5' tgcaagettggetgttttgg 3² Tm= 5' gatectacctgacgcttttta 3' Tm= 5' aaataatgaattegagctcggt 3' Tm= 5'ataaaaaaatcgagataaccgtt 3' Tm = 5'aggtcgactctagaggate 3' Tm= 5' tccataagattagcggatce 3' 5' tctcgcatgggggaccccac 3' 5'ctacctgttccatggccaac 3' Tm= 5' ttcgggcatggcactcttg 3² Tm= Tm= Tm =