What is the size for cut lane #5 to measure the Sac1?  The T-vector size is 3kb, what is the size for the insert?

HELPFUL INFORMATION: When doing automated sequencing, on the other hand, all 4 dideoxynucleotides are added to the same sequencing reaction, and run together in a single capillary gel. 1b What's the difference why can an automated sequencing reaction be done with all 4 dideoxynucleotides mixed together and run together, but not a conventional sequencing reaction?

Who makes the metal ring-based machine that makes the raised letters?

the task is to use this image to write a results section of a report about: Identification of Differentially Expressed Genes in Breast Cancer Using RNA-Seq. 1000 words would be best

can u help with this please thank you so much

Determine the rectangular arrays for the s1f1 configuration and determine all of the term symbols for the configuration.

Why are there multiple results returned when you input a sequence into BLAT or BLAST? How do you know which is most relevant? Does that make the others irrelevant?

What specific coding guidelines relate to the sequencing of anemia? When is it appropriate to sequence the anemia before the main illness?

Draw Design Layout References Mailings Review View Table Design Layout Tell me 2 Sha A A Aa v E • E v E = = 12 AaBbCcDdEe AaBbCcD AaBbCcDdE AaBb . AaBbCcDdEe U v ab x, x' A v Av No Spacing Heading 1 Title Styles Pane Normal Heading 2 Dictate Sensitiv 2) Two agouti mice, genotypes AaBb, are bred together. What phenotypic ratio would you expect in the next generation? Set out the crosses using a Punnett square. Gametes Completed forms to be made available for external moderation. I Phenotype Ratio:... .. 985 words English (United Kingdom) Focus

A research group collaborating with the hospital extracted DNA from the peripheral blood leucocytes of the patient V.1, her sister V.2, her mother IV.1 and her father IV.2 with consent and ethical approval for experimental work involving human tissues. These specimens were used for sequencing studies to screen for causative variants in amyloid precursor protein (APP), presenilin-1 (PSEN1) and presenlin-2 (PSEN-2) genes. The outcome is shown in Fig. 2 below. APP IV.1 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG V.2 961 TACGGCGGATGTGGCGGCAACCGGAACAACTTTGACACAGAAGAGTACTGCATGGCCGTG -Y--G--G--C--G--G--N--R--N--N--F--D--T--E--E--Y--C--M--A--V- Amino Acid IV.2 961 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 TACGGCGGATGTGGCGGCAACCGGAATAACTTTGACACAGAAGAGTACTGCATGGCCGTG 1020 Amino Acid -YGGCGGNRN NFD TEEY C-M-A-V-340 V.1 961 PSEN-1 IV.1 361 V.2 361 Amino Acid PSEN-2 1020 1020 340 CATACCGACACTCTCCCCCACACACCCCTGCACTCAATTCTCAATCCTCCCATCATCATC 420…