pXO1 and pXO2 are large plasmids – large pieces of DNA that are not the chromosome that can replicate independently of the chromosome. What can a Bacillus anthracis cell with a pXO2 plasmid do that a cell without pXO2 can’t? I need help answering this quwhstion as short as possible based of what is said in the paper
Q: Which substance is a molecule rather than an element? O hydrogen carbon dioxide O phosphorous O…
A: Elements and molecules are the different forms of chemicals present in the surroundings as well as…
Q: The nurse practitioner prescribed 500 micrograms of Risperidone. The stock solution available in a…
A: Risperidone is an atypical antipsychotic medication used to treat schizophrenia and bipolar…
Q: Compare and Contrast a Chlorophyll lacking plant
A: Chlorophyll-lacking plants and fungi are both organisms that lack the essential green pigment…
Q: ACTIVITY 6 1. Taste is sensed by receptors called. 2. Name the four main tastes. 1. 2. 1. 2. 3. 3.…
A: ANSWER) The perception of taste is received when the chemicals in the edible products gets…
Q: 1. Identify and explain the differences in organelles and energy sources between cellular…
A: Answer : photosynthesis and cellular respiration are two different processes photosynthesis occurs…
Q: explain the specificity and diversity exerted by the second massager
A: The second or secondary messengers play a crucial role in intracellular signalling pathways,…
Q: Same graph, or use your PDF version, but the LCT change and BMR change nu If this animal became more…
A: Given information The animal becomes more cold-acclimated by adding brown fat and fur. The Lower…
Q: transmission of pain from the periphery of the body to its perception in the brain.
A:
Q: demonstrate an understanding of human growth and motor development and apply it to the design of…
A: As a person grows from infancy to adulthood, their body goes through physical changes and expands in…
Q: 1. Transcribe and translate the mutated DNA sequences, CIRCLE the mutation, and classify each type…
A: The change in the sequence of the genetic material of an organism that results in any heritable…
Q: 10-Corynebacterium diphtheria related to: A-g+ve cocci B-g-ve cocci C-g-ve rods D-g+ve rods
A: The nasopharynx or skin can be infected with Corynebacterium diphtheriae. A strong exotoxin secreted…
Q: 9% of individuals within a population of butterflies are resistant to milkweed toxins, a trait which…
A: Introduction : Hardy Weinberg principle is based on certain assumptions. These are as listed as…
Q: 20. With respect to the Laws of Thermodynamics, what is the most important of the following roles of…
A: The process of photosynthesis takes place when the sunlight strikes the leaves and excites…
Q: 40 Listen Imagine that each year, 40 tons of fish meal are provided as food to captive fish in a…
A: The correct option is: 4 tons
Q: 2. Consider the scenario where a DNA mutation occurs in a person's skin cells, where the gene p53…
A: ANSWER: Because p53 is a gene that helps prevent cancer from developing, having a mutation in it…
Q: Priestley's experiments provide solid evidence that shows that plants give off oxygen. Combining…
A: Metabolic processes are the activites takes place inside the living organisms in which either large…
Q: Describe what a pseudogene is and what impact they have on gene expression
A: A pseudogene is a nonfunctional gene that can be compared to junk DNA.
Q: In terms of efficient reproductive strategy, which is better between articulate and inarticulate…
A: With exception of three particular taxa brachiopods are typically gonochoristic creatures with…
Q: iCQ5) viruses are able to by using the enzyme integrase. a) Lysogenic; Release from the cell without…
A: An infectious bacterium called a virus is made up of a protein-coated fragment of nucleotides.
Q: Pre-lab task 1: on the other side of this page, note the size range for typical Escherichia coli…
A: INTRODUCTION E. coli bacteria are commonly found in the intestines of healthy humans and animals.…
Q: 9. Which hormone is called a "natural painkiller?" cortisol a. b. C. d. prolactin endorphins…
A: Pain, whether physical or emotional, is something that is an all-too-familiar experience for many of…
Q: What is a technique often used to study the three-dimensional structure of proteins? A.X-ray…
A: Proteins are made up of amino acids, which is the primary structure of proteins, the secondary…
Q: B. Compare the trophozoites of the following parasitic and commensal amoeba. Structure Nucleus…
A: trophozoites:- it is a stage of growth of the sports of parasites inside the host in which they…
Q: What is the arthropod's role in disease transmission such as malaria? Question 7 options: a)…
A: Arthropods, especially ticks and mosquitoes, are responsible for a number of parasitic and viral…
Q: Differentiate between aneuploidy and polyploidy
A: Chromosomal variations refer to any changes or differences in the number or structure of chromosomes…
Q: Imagine you are a student in Alfred Hershey and Martha Chase's lab in the late 1940s. You are given…
A: Hershey and Chase experiment was just like a milestone in the history of genetics.By this experiment…
Q: Evolution is biology's 's core theme that ties together all the other themes. This is because…
A: 1.) According to the RNA world hypothesis life on earth began with a simple RNA molecule that could…
Q: Describe the major identifying characteristics of Giardia lamblia (intestinalis), including a…
A: Protists are unicellular eukaryotes. These are phototrophic or heterotrophic microbes that are…
Q: What are the three categories of biological agents?
A: Biological agents also referred to as biological weapons, are microorganisms, viruses, or toxins…
Q: I was told the correct answer is 0.006. Please advise why this one is diffrent
A: Introduction The fundamental piece of genetic information given from parent to child is the gene.…
Q: Any break in the chain of infection prevents the spread of disease. Question 4 options: a)…
A: True.
Q: Droplets, aerosols, saliva, feces, sexual fluids, blood and pus are all? Question 1 options:…
A: The answer is: a, d and f.
Q: explain the steps of what might happen inside a healthy mammary gland epithelial cell after it is…
A: UV light, or ultraviolet light, is a type of electromagnetic radiation with a wavelength that is…
Q: The primary function of 5' & 3' end mRNA modification is: a. To ensure that phosphorylation of the…
A: The mRNA synthesized by transcription undergoes modifications before they bind with ribosomes for…
Q: 2. Consider the energy systems an 800m track athlete would use during a race. In a scenario where…
A: a) During the first 400m of the race they feel strong and quick because the warm up helps them to…
Q: A sample of E.coli cells is transformed with a plasmid containing a transcriptional fusion including…
A: (c.) It is given that an E. coli cell is transformed with a plasmid containing a transcriptional…
Q: believe is portals of exit because is the route by which an infectious aent leaves the host.
A: Yes, this can be one of the option that can be correct. Droplets, aerosols, saliva, feces, sexual…
Q: What are the three categories of biological agents? Which of the three categories are the greatest…
A: The potential for a weapon of mass destruction (WMD) attack has been a concern for public health…
Q: 3. What is the critical role of oxygen in cellular respiration, that without it, aerobic respiration…
A: Cellular respiration: A sequence of chemical processes known as cellular respiration convert glucose…
Q: Using the techniques below in the laboratory experiments, devise a detailed methodology in solving…
A: DNA testing and analysis can identify an individual's unique genetic makeup and help tailor…
Q: Describe the specificity of glucose oxidase. Compare it with the three other methods.
A: A specific enzyme called glucose oxidase catalyses the oxidation of glucose in the presence of…
Q: The function of DNA ligase is to: a. Catalyze formation of phosphodiester bonds between adjacent…
A: DNA ligase plays a crucial role in the synthesis, repair, and replication of DNA molecules. It is an…
Q: Explain how the temperature of the human body is regulated
A: Maintaining constant bodily conditions is part of homeostasis. The stability of the environment is…
Q: The following question will be scored. Which of the following scientific investigations may use a…
A: A compound light microscope is a type of microscope that magnifies an image by combining lenses. In…
Q: 9. For organism Z, 2n = 36. What is the diploid chromosome number (2n) and DNA content (C) of…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Excavata Diplomonads- Two separate nuclei, no plastids, no true mitochondria, multiple flagella.…
A: Rhizaria • Cercozoa - Amoebas, flagellates, and slime molds • Foraminifera - Single-celled organisms…
Q: Imagine that you are part of a research team that specializes in diagnosing disorders associated…
A: Muscular dystrophy is a collection of illnesses that impair the human body's voluntary muscles. This…
Q: draw a woody dicot stem and make sure to label while drawing the diagram
A: Woody dicot stem is characterized as follows: Presence of bark as the outermost part. The cortex,…
Q: Directions: Given the DNA strand below. Decode the hidden message in the proteins that will be…
A: DNA is the genetic material seen in most of the organisms. DNA is double helix structure which…
Q: how are methods of analysis in epidemiology determined?
A: Epidemiology helps us understand the distribution of diseases in a population, including factors…
pXO1 and pXO2 are large plasmids – large pieces of DNA that are not the chromosome that can replicate independently of the chromosome. What can a Bacillus anthracis cell with a pXO2 plasmid do that a cell without pXO2 can’t?
I need help answering this quwhstion as short as possible based of what is said in the paper
Step by step
Solved in 2 steps
- what is plaque essay? what is the purpose of this lab? why this lab is perform? (bacteriophage) what techniques is used and how can we derive information(data)? methologies, theory, mechanism for reactions that lead to observable results. required information on microbial metabolism. why is the microbe doing this?You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCGGC GAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGTQUESTION 10 You grow this weird looking organism in lab and have no idea what it is. You decide to sequence its genome and one of the reads you get back is shown below: >UnknownSequence1 GCGGTATTTGACGCCGCATTCGAAGTGGTCGATCCATTCGGCGTATCAGGACAATTTGCATATGTTGACGTTGTCGCGGGGTGGGCCCTCGATCTGGATGTCGGAGCGGGACGCG GCGAAGATCGGTGTGGCCGATAATGATTGGATCGAGGCGGTCAATCGTAACGGGGTGGTGGTGGCGCGGGCGATCGTGT
- Difference between Capsule and Microcapsule in bacteria.All of the following are possible configurations of bacteria EXCEPT? Monococcus O Streptococcus Diplococcus OLactobacillus Which of the following is NOT an accessory organ in the digestive system? Liver Pancreas Duodenum Gall bladderWhat is the group of bacteria found in both the rumen of cattle and shidge of sewage treatment?Please provide the answer with a plagiarism-free proper explanation. Kindly also refer to the NCERT 12th Biology.
- of bacteria. The Gram stain works because of differences in the O 1) cell membranes O 2) genetic characteristics O 3) capsules O 4) antigens O 5) cell wallsBacteria per Gram of Beef After Temp. (°C) 6 hr 12 hr Staphylococcus 43 140,000,000 740,000,000 aureus 51 810,000 59,000 53 650 300 Salmonella 43 3,200,000 10,000,000 Typhimurium 51 950,000 83,000 53 1,200 300 Clostridium 43 1,200,000 3,600,000 perfringens 51 120,000 3,800 53 300 300 Draw the growth curves for each organism. What holding temperature would you recommend? Assuming that cooking kills bacteria in foods, how could these bacteria contaminate the cooked foods? What disease does each organism cause?- Mycoplasma MICROBIO-VIROLOGY advanced have gram positive cell walls are cells with prokaryotic organization are bacteria typically found in contaminated soils. can have intracellular replication. cause skin infections. - Which of the following amino acids has a hydrophobic side chain? BIOCHEMISTRY basic Methionine Glutamine Lysine Serine Glutamic acid - Which of the following is true regarding viruses? MICROBIO-VIROLOGY basic Released viral particles during cell lysis or budding arecalled virions. Viruses have a protein capsid and an envelope. Viruses are obligate intracellular parasites. Virus genome can be DNA, RNA, single or double stranded. Outside the host, viruses are inactivated within 24 hours. - On the respiratory system what are the correct statements? PHYSIOLOGY basic Partial pressure of carbon dioxide (pCO2) is higher in alveoli than in atmospheric air. Surfactant reduces surface tension within the alveoli Elastic recoil of the lungs…
- Naming and Classifying Microorganisms 1. Recognize the system of scientific nomenclature that uses two names: a genus and a specific epithet. 2. Differentiate the major characteristics of each group of microorganisms. 3. List the three domains. A Brief History of Microbiology 1. List at least four beneficial activities of microorganisms. 2. Name two examples of biotechnology that use recombinant DNA technology and two examples that do not. 3. Explain the importance of observations made by Hooke and van Leeuwenhoek. 4. Compare spontaneous generation and biogenesis. 5. Identify the contributions to microbiology made by Needham, Spallanzani, Virchow, and Pasteur. 6. Define bacteriology, mycology, parasitology, immunology, and virology. 7. Explain the importance of microbial genetics and molecular biology.What is meant by the term "staphylococcus"? O Bacteria that are round and arranged in clusters Bacteria that are round and arranged in chains Special bacteria that are spiral-shaped O Bacteria that are rod-shaped and found in groups Which of the following is false regarding a DNA molecule? It contains a double helix structure It stores genetic information It contains the nitrogen base Uracil It contains base pairsI U Cardo 12 1三 ニ 三 rI TI3 4. 111 I. 5. What are the basic shapes of bacterial cells? What are the basic Know the terms. Which types of organisms have axial filaments? How would classify the following in terms of gram stain reaction and shape and arrangement of the cells Escherichia coli? Staphylococcus aureus? Streptococcus pyogenes? Bacillus anthracis? Do these organisms cause any important diseases? arrangements? you III