12. You are working with a picce of DNA of the sequence:5'-TATTGAGCTCCCCGGAT-33'-ATAACTCGAGGGGCCTA-5You cut the above piece of DNA with a restriction enzyme that recognizes thesequence 5'GAGCTC and cuts on the 3' side of the A within this sequence.Please, draw all products that you get after digestion. Label all 5' and 3' ends.

Restriction enzymes cut DNA at a specific location called as restriction site.

Answered: 12. You are working with a picce of DNA…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

8. You have a piece of DNA with the sequence shown below. 5-AAAGTCGCTGGAATTCACTGCATCCCCGGGGCTATATATGAATTCGATGCGTACTTGGCACG-3' 3'TTTCAGCGACCTTAAGTGACGTAGGGGCCCCGATATATACTTAAGCTACGCATGAACCGTGC-5' You cut this fragment with the restriction enzyme EcoRI. The recognition site for EcoRI is 5-GAATTC-3' 3-CTTAAGS" EcoRI cuts at the site and in the manner indicated by the arrows to yield fragments with overhanging ends. 3-СТТААG-5' 5'G AATTC-3' 3-СТТАА G-5' Draw an illustration showing how the piece of DNA is cut by EcoRI and how many fragments result. Show all the base pairs and the overhanging ends at the ends of the DNA fragments.
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' G G T ACC 3' 3' CCATGG 5' y CCATGGS Kpnl Acс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.
25. The restriction enzymes Kpnl and Acc651 recognize and cleave the same 6-bp sequence. You have a plasmid and a linear DNA strand that both contain a Kpnl and Acc651 sequence in the same orientation as shown below. You digest both DNA pieces with both enzymes and then attempt to ligate the sticky ends, followed by treatment with DNA ligase. What will happen? 5' GGTACC3' 5' GGTACC3' 3 CCATGGS 3 CCATGGS Kpnl Aсс651 A) You will produce sticky ends but the two types of ends will not ligate. Instead, you may produce a small amount of religated plasmid where the digested plasmid sequence re-inserts. B) You will produce a recombinant plasmid in which the linear DNA strand is ligated in between the two sites, suitable for cloning. C) You will produce blunt ends that will not ligate because the two restriction enzymes will both operate on both of the sites. D) All the DNA will be completely digested as if you had applied a general DNAse enzyme.
In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and RNAs) always to specify base sequence in 5' > 3' direction unless otherwise directed 1. From the base sequence 5' A-T-G-C-C-A 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand 2. From the base sequence 5' T-A-A- C-C-T 3' in a DNA template strand, determine the base sequence in hnRNA synthesized from the DNA template strand
The partial sequence of one strand of a double-stranded DNA molecule is5′ – – – GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG – – – 3′The cleavage sites for the restriction enzymes EcoRI and PstI are shown below.Write the sequence of both strands of the DNA fragment created when this DNA is cleaved with both EcoRI and PstI. The top strand of your duplex DNA fragment should be derived from the strand sequence given above
5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3' 3' CACGATCGCCCTTACTCGACCCTATGATCATCCCGA 5' Template Strand: 9. Using the template strand, transcribe the DNA above, Be sure you write your sequence 5 - 5 a indicate the 5' and 3' ends of any nucleic acid molecule(s). 10. Use the codon chart below to translate your mRNA into an amino acid sequence. Begin at the first codon. Third First position (5' end) Second position position (3'end) UGU Cys UAU Tyr Cc UGC Cys UGA Stop UGG Trp UCU Ser -Y UAC Tyr UAA Stop UAG Stop UUU Phe - F UUC Phe UUA Leu UUG Leu FL UCC Ser -- UCA Ser UCG Ser CGU Arg CGC Arg ER CGA Arg CGG Arg CCU Pro CAU His CUU Leu CUC Leu -- CAC His CAA Gln CAG Gln CCC Pro -P A - CUA Leu CUG Leu CCA Pro CCG Pro AAU Asn AAC Asn AGU Ser AGC Ser AGA Arg ACU Thr AUU lle AUC lle AUA lle AUG Met M ACC Thr -T ACA Thr ACG Thr A. AAA Lys K AAG Lys -R AGG Arg A. GAU Asp -D GAC Asp GGU Gly GGC Gly GCU Ala GUU Val GUC Val GCC Ala A -G GGA Gly GGG Gly A -V GUA Val GUG Val GCA Ala GCG Ala GAA Glu -E…
EcoRI recognizes G A-A-T-T-C sequence and cleave/ cut between G and A. How will the DNA fragments look like if EcoRI is used for the DNA below? How many fragments are produced? 5- AAAGATTTGAATTTCGAATTCAATTTAAGAATTCCCTTAGAATTTCC -¹3
1. What are restriction enzymes and what do they do? 2. Complete the chart Original DNA sequence 5' TGA CCA CTC GAG CAT AAC GAG TCG CTC 3° Write the complementary strand's sequence * remember it will be opposite directionality (the number at the ends are different) * pairs are A-T and C-G |Copy and paste your double stranded DNA into this box. You are going to use the restriction enzyme Xhol. Mark the cut site by changing the color (highlight or change text color) of one double-stranded piece * it cuts between the C and the T (cut shown as slash symbol): 5’ C/TC GAG 3' * remember it cuts BOTH strands (the restriction site is palindromic). Hint: read each strand in the 5'à 3' directions to find the cut site
The total (50ul) of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the gel?
9. The restriction site sequence for the restriction enzyme Sau3Al and BamHI include four identical bases, making their sticky ends identical as shown in the figure. Let's say you have foreign DNA whose flanking regions were cut with Sau3AI. Also, you want to use a plasmid containing a BamHI restriction site. (1) Would it be possible to ligate the foreign DNA into the BamHI site of the plasmid? Explain. lison Lenharc (2) Would it be possible to cut the ligated sites with Sau3AI? What about BamHI? What problems will you expect if you use BamHI? BamHI Sau3Al G-G-A-T-C-C பர்டிய C-C-T-A-G-G G-A-T-C Hi- 目1目 C-T-A-G C-C-T-A-G C-T-A-G G-A-T-C-C E E G-A-T-C= 10. An ampicillin-resistant, tetracycline-resistant plasmid, pBR322, is cut with Pstl, which cleaves within the ampi resistance gene. The cut plasmid is ligated with Pstl digested Drosophila DNA to prepare a genomic library, and t rcoli K12
A piece of DNA fragment is sequenced. You clone the the fragment, isolate the cloned DNA fragment, and set up a series of four dideoxy reaction. You then separate the products of the reaction by gel electrophoresis and obtain the following banding patter: ddATP ddTTP ddCTP ddGTP What is the base sequence of the original fragment that you were given? 5'-TAAGCTGA-3' O 5'-ATTCGACT-3' O 5'-TCAGCTTA-3' O 5'-AGTCGAAT-3'
3. Primer Design You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To do so, you must amplify the entire region of AATG repeats. Design primers of 16 bases each so they anneal outside the region of interest. More than one primer pair is possible, but just give one. 51-АСTСGCАCGAACAGGCACTTAGGAATGAATGAАTGAATGAATGAАTGAATGACCTGтстссттсССАСТтсстСС-3' 3'-TGACCСтGтсттстссстGААТССТТАСТТАсТТАСТТАСТТАСТТАСТТАСТGGACACACCAAGGстСAAGGAGG-5' a. Primer 1: Primer 2:

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS