Label the 5' and 3' ends of DNA and RNA and the amino and carboxyl ends of the protein. Assume it is read left to right and the columns represent transcriptional and translational alignments.
Q: The steady state level of a mRNA for a gene is affected by the following mechanism(s)
A: Messenger ribonucleic acid (mRNA) is a single-stranded RNA molecule that is linked to genetic…
Q: Assume the following portion of an mRNA. Find a start signal, and write the amino acid sequence that…
A: The sequence of protein is usually notated as a string of letters, according to the order of the…
Q: Explain why the translation of a given mRNA can be inhibited by a segment of its complementary…
A: A mechanism of reading and decoding the nucleotide sequences of messenger ribonucleic acid (mRNA)…
Q: What MRNA sequence codes the tripeptide shown below (write code in direction of N-terminus to…
A: Peptides are present in all individuals which are living. Peptides play may functional roles in our…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The translation is a process through which a polypeptide chain is synthesized based on the sequence…
Q: If the nonsense mutation is in the last exon of the mRNA, the result would be:
A: Exons are sections of an RNA transcript, that code for a protein. Exons are separated by non-coding…
Q: You may wish to consult the genetic code above to answer the following question. A mutation has…
A: Missense mutation is the mutation in which single amino acid change occurs. The other amino acid in…
Q: A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table,…
A: With the help of translation process protein forms. The nucleotide sequence are translated into…
Q: Label the N-terminal and the C-terminal in the above peptide.
A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…
Q: segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…
A: For protein synthesis, messenger RNA must be made from one strand of DNA called the template strand.…
Q: Indicate which of the following items are associated with transcription or translation. This could…
A:
Q: Which of the following is the MRNA coding for the peptide trp-met-gly- ser-his? A.…
A: The genetic codes are the sequence of nucleotide that governs the formation of proteins.
Q: Use the genetic code to complete the following table. Assume m that reading is from left to right…
A: In DNA double helix Adenine (A) pairs with Thymine(T) and Guanine (G) pairs with Cytosine (C).…
Q: In protein biosynthesis, the first codon of the new amino acid chain corresponds to: a. C…
A: The codons are triplets of nucleotides present in the mRNA sequence. There is a total of 64…
Q: Three bases on MRNA that translate into an amino acid are called:
A: A translation is a process of conversion of mature mRNA molecules into long chains of a polypeptide…
Q: Choose whether the statement is TRUE or FALSE "There are no aminoacyl-tRNAs that will go to the A…
A: Protein synthesis ends when one of the 3 stop codons :-: UAG (amber) UAA (orchre) UGA(opal) Enters…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: If the DNA triplet is TTA, then the transcribed MRNA codon would be
A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*
A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…
Q: Using the given information, determine the correct order of the following events during translation:
A:
Q: The following sequence is the coding strand of a piece of DNA. Type out the corresponding template…
A: The protein sequence can be decoded by a coding or template DNA given. The mRNA strand is the same…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: Assume the following portion of an mRNA. Find a start signal, and writethe amino acid sequence that…
A: The process in which amino acid is incorporated into the polypeptide chain with the help of a…
Q: In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a…
A: DNA or deoxyribonucleic acid is a double-helical molecule consisting of two polynucleotide chains.…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…
Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…
A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…
Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…
A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…
Q: Write the standard base sequence of the messenger RNA that would cause a ribosome to make the…
A: The amino acids in the protein are placed in the order from N-terminus to C- terminus. The mRNA are…
Q: Indicate the class of drug that is stopping polypeptide translation: change 30S subunit…
A: Translation is the process of Synthesis of proteins with the help of mRNA, tRNA and ribosome. Some…
Q: Use Table 1 to read the codons below. Find the name of the amino acid and write it in the space…
A: b) UUA: Leucine c) GAG: Glutamate d) UAU CUA: Tyrosine-Leucine e) AUC UUG: Isoleucine-Leucine
Q: Identify the secondary structures present in the protein and its genes code…
A: Proteins are large biomolecules that compose structural and motor elements of a cell, and also as…
Q: An RNA polymer is made by using the enzyme polynucleotide phosphorylase with equal quantities of CTP…
A: The amino acids are coded by the group of three bases called base triplets and codons.
Q: Describe how an Rna molecule is translated into a protein at the ribosome
A: The process of synthesis of protein from RNA is known as translation and occurs within a specialized…
Q: Which translation factor mediates the aminoacyl-tRNA entry into the A site of the ribosome? A.…
A: The translation process is responsible for synthesizing the protein in the cytoplasm of the cell.…
Q: If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA…
A: The central dogma of life involves three major steps that include: DNA replication: This is the…
Q: Define the following terms: a. posttranslational modification b. transpeptidation c. translocation…
A: Translation is the process by which protein is synthesized by translating the mRNA molecule to…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…
Q: Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for…
A: Translation is the process during which codons in mRNA are identified by tRNA with specific…
Q: The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase…
A: DNA and RNA are the biomolecules that make up the part of our genetic material. DNA is the genetic…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…
A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…
Q: Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence:…
A: So the given m-RNA code for - met-glu-ser-leu-leu.
Q: T-A-C |А - А - G А - т-G G-G-G А -т-т DNA enter answer - enter answer enter answer - enter answer…
A: DNA mRNA TAC AUG AAG UUC ATG UAC GGG CCC ATT UAA
Q: A mRNA has the following sequence and direction: 5’-AUGUCAACCUAA-3’ What would be the anticodon…
A: Messenger RNA (mRNA) carries the genetic information copied from DNA in the form of a series of…
Q: If methionine is always the first amino acid incorporated into an oligopeptide, what oligopeptide is…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is…
A: In some operons like tryptophan operon, transcription starts from transcription start site, but get…
Q: Complete the following sentence: RNA splicing removes the non-coding sequences (_----_) from…
A: RNA splicing process helps to translate mRNA into protein.
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Translation is the process of synthesis of proteins from mRNA. During the process of translation,…
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG Gw/opCulGACU GAC UC 4C According to the Genetic Code Sheet below, which of the following amino acid sequences corresponds to this MRNA strand? CỤC AAG UGC UUC PHE GLU ASP SER ALA TYR U A STOP A GU VAL U CIS U U G A STOP IG TRP ARG AC U LEU SER UG PRO ASN HIS THE GLN MET ILE ARG O a lys-leu-cys-phe O b glu-cys-pro-phe leu-lys-cys-phe O d leu-glu-leu-val U...pdfUsing the table of genetic code, choose the CORRECT protein sequence that will be produced from the following sense strand of DNA: 5'-AUG UCU GAC UAG TTG GAT CCC - 3' Second position First position (5' end) Third position (3' end) Phe Ser Tyr Cys U Phe Ser Тут Cys Leu Ser Stop Stop A. Leu Ser Stop Trp Leu Pro His Arg Leu Pro His Arg Leu Pro Gln Arg Leu Pro Gln Arg Ile Thr Asn Ser U Ile Thr Asn Ser Ile Thr Lys Arg A Met Thr Lys Arg Val Ala Asp Gly U Val Ala Asp Gly C Val Ala Glu Gly A Val Ala Glu Gly O a. Lys-His-Ala-Gly-Asn-Leu-Val O b. Val-Val-Ser-Pro-Leu-Asp-Thr
- Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First PositionIf DNA segments changes from GCATAG to GCATA, this is a: MRNA Codon/Amino Acid Chart First Base Second Base Third Base U A G 0001 Phenylalanine UCU UAU1 Tyrosine (Tyr) UAC UGUT FCcysteine (Cys) UGCJ U UUCJ (Phe) UCC Serine (Ser) UCA U UUA1 UAAT UGA - Stop A FLeucine (Leu) UUG- FStop UAG- UCG- UGG - Tryptophan (Trp) G CU- CCU CGUT CAU1 Histidine (His) CAC U CUC FLeucine (Leu) CUA CC Proline (Pro) CCA CGC FArginine (Arg) CGA CAA1 Glutamine A CAGI (Glu) CGG- CUG- CCG- G AUU AAU1 Asparagine ACU1 AGUT FSerine (Ser) AGC- AUC FIsoleucine (le) ACC Threonir AACJ (Asn) A AUA- ACA (Thr) AAA1 FLysine (Lys) AAG- AGA, FArginine (Arg) AGG- A Start Methionine (Met) ACG- AUG - GUU- GCU GAU- GGU | Aspartic Acid GAÇJ(Asp) U GỤC Valine (Val) GUA GCC FAlanine (Ala) GGC Glycine (Gly) GGA G GAA1 Glutamic Acid A GCA GCG- GAGJ (Glu) GGG- GUG- GExplain what is meant by the concept of "central dogma of molecular biology". Name the main processes involved in this dogma and highlight the roles of the different types of RNA molecules involved in them. Point mutations in multiple tumor suppressor proteins have been linked to cancer. For example changes in the gene for adenomatous-polyposis-coli protein (APC gene) may result in colorectal cancer. Consider the following DNA sense strand. 3'-TAC CGG TTG TGA AGC TGA ATC-5' (i) (ii) (iii) (iv) Derive the mRNA molecule from the given DNA strand sequence above, paying attention to the polarity of the molecule. Write down the polypeptide chain sequence arising from the mRNA molecule of the question above, using the table of the genetic code (Table Q1 overleaf) and indicate the C- and the N-terminus of the peptide chain. Point mutations of a cytosine (C) often lead to the dysfunction of the APC protein. Write down all possible polypeptide chains that can result from all possible DNA…
- Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Event Tryptophan high Tryptophan low Ribosome does not stall at Trp codons ____________ ____________ Region 2 of the leader pairs with region 3 ____________ ____________ Ribosome covers part of region 2 of leader ____________ ____________ Transcription is terminated before structural genes are transcribed ____________ ____________For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino AcidThe DNA sequence below is transcribed from left to right (the partner/coding strand is shown). Using this sequence, write the sequence of the polypeptide that results from this gene. Be sure to appropriately label the ends of the molecule. 5'-ATGCACGGCGACTAG-3' Second letter A UAU Tyr UAC First letter U A G U UUU1 UUC UUA LOU Leu CUU CUC CUA CUG Phe GUU GUC GUA GUG Leu AUU AUC lle AUA AUG Met Val C UCU UCC UCA UCG CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC GCA GCG Ser Pro Thr Ala CAU His CAC CAA CAG Gin AAU Asn AAC AAA 1 Lys AAG LYS G {}a UAA Stop UGA Stop A UAG Stop UGG Trp GAU 1 GAC Asp GAA GIU Glu GAGJ UGU UGC CGU CGC CGA CGG AGU AGC AGA AGG Cys GGU GGC GGA GGG Arg Ser Arg DOA DOA DOA DUTO Third letter Gly