If the template strand of DNA carries the code: GGT-AAT-ACT, then what is the corresponding mRNA code?

Write down the complementary mRNA sequence for each of the following DNA sequence. A: TACCTAGCGCACATGTAGGTGGGCAAAGTT B: TAC ATG GTT ACA GTC TAT TAG ATG CTA TTT ACT TAG

Dystrophin is mutated in the disease, causing a codon to change from GGA to UGA. What is the consequence of this change? (

As you should recall, DNA, when not being actively transcribed, has a double helical structure.  This portion of the DNA has had the two strands separated in preparation of transcribing for a needed protein.  The following is one of the two complimentary strands of DNA: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written convention, i.e. the 3'-5' orientation, is this the coding strand or the template   strand?  ______________________________ Q:  Assuming this strand extends from base #1 to #61 (going left to right), interpret the correctly transcribed mRNA and translated polypeptide for bases 24 - 47: mRNA:      ___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___-___- polypeptide chain:  ________--________--________--________--________--________--________--________

In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a codon if only the first two nucleotides of the codon are known?

Consider the mRNA sequence below. Assume that the following mRNA segment has been translated. 5'-GCAAGUCUUAAU-3' Note for numbers 1 and 2: Use the three-letter abbreviation of amino acid; separate amino acids with a hyphen: do not include the stop codon. Example: ala-cys-glu 1. Using the table of the genetic code, determine the sequence of amino acids. ala-ser-leu-asn 2. If mutation occurs by substitution of the 6th nucleotide with adenosine-5'- monophosphate, what is the resulting amino acid sequence? 3. What type of mutation occurred? Choose from same sense, missense and non-sense.

After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief moment occurs before the two exons are connected to each other. Which snRNP(s) hold(s) the exons in place so they can be covalently connected to each other?

The amino acid sequence for a short peptide is Tyr-Leu-Thr-Ala. What are the possible base sequences of the mRNA and the transcribed DNA strand that code for it? What are the anticodons?

For the following DNA bases, give the complementary mRNA code that would be transcribed from these bases: AGCTAATCGGCTACCAGGTACGGATATTCC

The following mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA UCC UCC ACU CCU UGA-3' Use the following codons and the amino acids they encode: AUG = Start or Met; UUU, UUC = Phe; UUA, UUG = Leu; UCU, UCC = Ser; CCU, CCC = Pro; ACU, ACC = Thr; UGA = Stop. Select one: O a. Phe-Leu-Ser-Ser-Thr-Pro O b. Met-Phe-Leu-Ser-Ser-Thr-Pro O c. Thr-Phe-Thr-Phe-Leu-Ser-Ser-Thr-Pro Od. Met-Phe-Leu-Ser-Ser O e. Thr-Phe-Thr