A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table, translate this sequence, assuming the first three nucleotides are a codon.
Q: If a tRNA has an anticodon sequence 3′–CCI–5′, what codon(s) can it recognize?
A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles. It includes…
Q: The following is a strand of mRNA: CAA GUG AAA ACA How many amino acids does the mRNA strand above…
A: The protein synthesis process requires the genetic material in the form of DNA to be transcribed…
Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…
A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…
Q: A certain mRNA strand has the following nucleotide sequence: 5'—AUG—ACG—UAU—AAC—UUU—3' What is the…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: Explain why the statement is correct. A section of the mRNA has a nucleotide sequence of…
A: mRNA A single stranded RNA which is copied from DNA and contains gene or information about specific…
Q: Given the following mRNA sequence: 5-AUCCCGUAUGCCCGGGAGCUAGCCCAGC-3 a) Label the first condon, the…
A: Transcription is a process through which the template DNA strand is transcribed into mRNA. mRNA…
Q: Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can…
A: Characteristic of genetic code: - The genetic code is a triplet (first suggested by Gamow in 1954).…
Q: list the amino acid sequence that would be made in a ribosome using these codons: AUG CUA AGU…
A: A ribosome consists of two basic pieces of units containing a large and a small subunit. During the…
Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence
A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…
Q: Use the table of the codons to answer the following question. Starting with the start codon, what is…
A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA molecule that codes for a…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…
Q: In the DNA sequence,the bottom strand is a template strand.if the base pair
A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…
Q: A ribosome binds to the following mRNA at the site indicatedby the dark box. At which codon will…
A: The mRNA strands obtained after the transcription of the antisense DNA strand (also known as the…
Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…
A: An open reading frame in molecular genetics describes the part of your reading frame that has the…
Q: An mRNA has the following sequence: 5' ACCAUGUACUGUCCUGCUGUUUGA 3'. Beginning from the start codon,…
A: In Amazon instant there are four type of nucleotide bases i.e adenine, guanine, cytosine and uracil.…
Q: Which of the following codons is called the start codon?
A: AUG is the Start codon, which codes for Methionine.
Q: The first amino acid in a purified bacterial protein is methionine. The start codon in the mRNA is…
A: The process of protein(amino acid) formation is called translation and it is the last step of the…
Q: Which of the following codons is not a termination codon for protein synthesis?a) UUUb) UAGc) UAAd)…
A: UUU is not a termination codon for protein synthesis. Hence option a is the right answer UUU codes…
Q: An mRNA has the following base sequence:5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′Identify the start…
A: Hereditary qualities are a piece of science stressed over the examination of qualities, hereditary…
Q: The first codon in a mRNA will be ____ and will code for ___ and the final codon will be ______ and…
A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…
Q: polypeptide peptide bond +amino acid tRNA codon anticodon UCA GCA CGU UGC GU ACG UCA ribosome MRNA
A: Translation is the process of formation of a sequence of amino acids using mRNA as a template. It…
Q: explain why a mutation in the dna nucleotide sequence that corresponds to the 3rd nitrogen base in…
A: A mutation is a change that occurs in our DNA sequence, either due to mistakes when the DNA is…
Q: For this RNA code, what is the final codon ? UACACGCCAGAGGUCGCCUUUACA
A: Introduction :- a DNA or RNA molecule that codes for a particular amino acid through a group of…
Q: An mRNA has the following sequence: 5′–CAGGCGGCGAUGGACAAUAAAGCGGGCCUGUAAGC–3′ Identify the start…
A: RNA (Ribo Nucleic Acid) is the genetic material found in prokaryotes and eukaryotes. It is the prime…
Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA
A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…
Q: Translate the following mRNA into protein, starting from the first initiation codon:…
A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…
Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…
A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…
Q: CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations…
A: DNA ( Deoxyribonucleic acid) is a ladder like helical structure which serves as genetic material in…
Q: Define the following terms as they apply to the genetic code:a. Reading frameb. Overlapping codec.…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: A sequence of mRNA is mutated such that there is no "start" codon. Which of the following is a…
A: The ribosomal binding on the mRNA requires the presence of Shine Dalgarno or kozak sequence upstream…
Q: The first column of the table below shows the beginning of a gene and five different mutations of…
A: Codon is a sequence of three nucleotides that codes for specific amino acid. Codons encode amino…
Q: Use the chart here to answer the following question. Second Base in Codon U A G UUU) UCU UAU] UACTyr…
A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…
Q: During transcription, a portion of mRNA is synthesized with the following base sequence.…
A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…
Q: Which of the following codons is called the start codon? a.UAA b.UGA c.UAG d.AUG
A: The connection between the series of nucleotide on mRNA and series of amino acid in the polypeptide…
Q: The translation of an mRNA begins with the codon AUG, and an initiator tRNA is required to start…
A: The ribosome starts translation, the assembly of a protein out of amino acids, when it encounters…
Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…
A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…
Q: Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation…
A: The translation is the biological process that involves the conversion of the genetic information in…
Q: Each tRNA has an _____ complementary to themRNA codon specifying the particular amino acid.?
A: Central Dogma of life is- DNA ---->mRNA -----> Protein The process of synthesis of a DNA…
Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…
Q: The following segment of DNA codes a protein. The uppercase letters represent Exons, the lowercase…
A: DNA and RNA are the biomolecules that make up the part of our genetic material. DNA is the genetic…
Q: Translation is the process by which the sets of 3 bases (codons) of the MRNA are read to specify the…
A: The translation is a process through which the mRNA gets translated into polypeptide chains. The…
Q: An mRNA has the following sequence: 5′–GGCGAUGGGCAAUAAACCGGGCCAGUAAGC–3′ Identify the start codon,…
A: The central dogma describes the flow of genetic information. It states that genetic information in…
Q: When a triplet of bases in the coding sequence of DNA is “GCA,” the corresponding codon for the mRNA…
A: there are two types purines and pyramidines. A=T G=C In case of mRNA A=U Thymine is replaced by…
Q: When the anticodon on a tRNA is "ICG, all of the following codons except can pair with this…
A: Some tRNA anticodon loops contain inosine (I) which allows recognition of multiple codons through…
Q: Determine the mRNA sequence for the wild type polypeptide by identifying the codons that correspond…
A: Polypeptides are chain of amino acids which is bonded by the peptide bonds. It is coded from the…
Q: Which of these features is found in eukaryotes but not bacteria?a. polygene mRNAs b. introns c. stop…
A: Living organisms are primarily classified as prokaryotes and eukaryotes. Prokaryotic organisms like…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: Translation is the process of formation of protein from mRNA As in the question above start codon is…
Q: The following diagram illustrates a step in the process of translation. Identify the following…
A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…
Q: Using the codon given for each amino acid (Find the table yourself) write the base sequence of mRNA…
A: The translation is one of the two processes by which gene expression takes place. Gene expression…
Q: An amino acid sequence reads:N—Met-Gln-Leu-Arg-Cys—C Write out one possible mRNA sequences with a…
A: The process by which mRNA is translated to the amino acid sequence is termed as translation. It…
A segment in the middle of an mRNA has the sequence 5¿- AGAGAACCGCGA-3¿. Using the codon table, translate this sequence, assuming the first three
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG G
- The codon chart below shows that adenine-uracil-guanine (AUG) codes for the amino acid methionine, and cytosine- adenine-guanine (CAG) codes for glutamine in humans. RNA Codon Chart UCAGUGA Alanine Tyrosine Stop Cystoine Stop Valine G U A GTryptophan Arginine A Leucine Serine Lysine Proline Asparagine ACU lGACU Select the two amino acids that those two codons code for in carrots. O glutamine O isoleucine methionine serine O valine oupne Glycine Phenyl- acid Asparti oartic acid Histidine Glutamine Arginine uauonejos Methionine ThreonineIf a codon GCA codes for the amino acid alanine in a prokaryote, what will it code for in a eukaryote? _____Use the codon chart to determine the following RNA strand in amino acids (Remember to write it the same way the strand is): ACA-AGG-UUA-UGA second letter C A UAU Tyr U UUU UCU UGU Phe Cys UUC UCC UAC UGC C Ser UAA stop | UGA stop| A UAG stop UGG Trp UUA UCA UUG Le UCG CUU CCU CAU CGU His CUC ССС CAC CGC Leu Pro Arg CUA ССА САА CGA Gln СCG CAG CGG CUG AGU AAU Asn AUU ACU Ser AGC S AGA Arg AAC AUC } lle A AUA АСC Thr AAA Lys АСА AUG Met ACG AAG AGG GUU GCU GAU GGU Asp GAC GGC Gly GGA GCC GUC Val Ala GAA GAG } GUA GCA Glu GGG GUG GCG Your answer first letter ACUCAGUCAGUCAG third letter
- On the mRNA codon table below, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5’cap is indicated by (5’). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5’)CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA(3’) In a previous round of replication, DNA polymerase made a mistake and added a C on what is now the DNA template strand. In the space on the mRNA sequence below, write the added base. Mark the codons again and write the amino acid sequence beneath them. What do you observe? (5’)CGUUACAAUGUAU CGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA 3’Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA sequence TAC GGA CAC GTT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Mutated DNA sequence TAC GGA CAC ATT CGC AAC mRNA sequence tRNA anticodons Amino acid sequence Type of mutation (highlight all that apply) Frameshift Nonsense Missense Silent Insertion Deletion SubstitutionAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
- If the sequence of amino acids encoded by a strand of DNA is serine-alanine-lysine-leucine, what is the order of bases in the sense strand of DNA? Use the codon chart below to help you: second letter A G UAU Tyr UGU UUU UCU Phe Сys UUC UCC UAC UGC Ser UAA stop |UGA stop | A UAG stop UGG Trp UUA UCA UUG Leu G UCG CUU CCU CAU CGU His CUC ССС САС CGC Leu Pro Arg CUA ССА САА CGA Gln CUG CCG CAG CGG AUU ACU AAU AGU Asn Ser AUC le A AUA AAC AAA AGC AGA Arg АСС Thr ACA AUG Met | ACG AAG Lys AGG GUU GCU GAU GGU Asp GUC Val GUA GAC S GAA Glu GCC GGC Gly GGA Ala GCA GUG J GCG GAG GGG) O 3' AGACGTTTCAAT 5' O 3' UGUGCAAAGUUA 5' О 5 TGTGCTTТCТТА 3' first letter UCAG UCAG PCAG third letterUsing the codon table, identify a 5’-3’ sequence of nucleotides in the dna template strand for mRna coding for the polypeptide sequence NH2-PHe-Pro-lys-COOH.Use the genetic code table. Which amino acid is coded for by only one codon sequence? Second Position U A G UUU Phe /F UCU UAU UGU UUC Tyr/Y Cys/C UCC UAC UGC Ser /s UUA Leu /L UCA UAA STOP UGA STOP UUG UCG UAG STOP UGG CUU CCU CAU CGU CỤC His / H Leu /L CC САС Pro / P CGC CUA ССА Arg/R CAA CGA CUG Gln /Q CCG CAG CGG AUU ACU AAU AGU AUC le /i ACC Asn / N Ser /S Thr/T AAC AGC AUA ACA AAA AGA AUG Met / M ACG Lys/K Arg/R AAG AGG GUU GCU GAU GGU GUC Asp/ D G Val /v GCC Ala / A GAC GGC GUA GCA Gly/G GAA GGA GUG GCG Glu /E GAG GGG valine serine threonine isoleucine methionine MacBook PrO G Search or type URL +, #3 Third Position SCAG UCAGU CAGU CA First Position