Use the genetic code to complete the following table. Assume m that reading is from left to right and that the columns represent transcriptional and translational alignment. 3' C 5' DNA double helix 5' T G A 3' 5' с А U 3' MRNA transcribed C A Appropriate tRNA anticodon 3' G 5' Amino acids incorporated into protein. Trp ww.tr

Use the genetic code to complete the following table. Assume m that reading is from left to right and that the columns represent transcriptional and translational alignment. 3' C 5' DNA double helix 5' T G A 3' 5' с А U 3' MRNA transcribed C A Appropriate tRNA anticodon 3' G 5' Amino acids incorporated into protein. Trp ww.tr

Name: Need answeres here. Thank you. Use the genetic code to complete the fo
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Need answeres here. Thank you. Use the genetic code to complete the following table. Assume m that reading is from left to right and thatthe columns represent transcriptional and translational alignment.3' C5'DNA double helix5'TGA3'5'с АU3'MRNA trans

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

For each of the following items, fill in either the DNA strand, the MRNA codons, the tRNA anticodons, or the amino acid sequence that have been left blank. If several sequences might work, choose only one. Furthermore, circle the start and the stop codons of each mRNA sequence. 1. DNA (3'-5') ACG TAC GGC CGG TTA AAG CAT ACT TTC TTG MRNA TRNA Amino Acid 2. DNA (3'-5') MRNA AUG ACU AGC UGG GGG UAU UAC UUU UAG AAA TRNA Amino Acid 3. DNA (3'-5') MRNA TRNA GCU CCU UAC CAC ССС CGU AUG GCU GGG AUC Activate Go to Sett Amino Acid
For the tRNA below, determine which amino acid it is charged with. attached amino acid G G GA 5' end c GOGGAUUU CUC G GAGC G C GCSAK & A 3' end ASSAGGCUUAA GACAC CCUGUG עכטט A GAAD anticodon C T U anticodon loop A G
Match the following (Most appropriate combinations only): IF1 IF3 IRES Shine-Dalgarno sequence m7-G Cap aminoacyl tRNA synthetase proofreading elF4E [Choose ] Binds ribosome A site Translation initiation in eukaryotes Translation initiation in Bacteria binds mRNA cap in eukaryotes Binds ribosome E site Correct charging of a tRNA with amino acid Cap-independent translation initiation of some viral mRNAs [Choose ] [Choose ] [Choose ] [Choose ]
Which of the triplets below is a possible anticodon for a tRNA that transports Leucine (Leu) to a ribosome? Second letter C UGU cys UCU1 UCC UCA UCG UAU Tyr UACS Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUU UGCS Phe UUC U UUA UUG FLeu CAU HiS CGU] CUU CUC Leu CCU ССС CCA CCGJ CACS CGC Arg CGA CAA GIn Pro C CUA CUG J CAG S CGG AUU AUC lle AUA AAU Asn AGU ser ACU АСС Thr ACA AAC AAA ys AGA Arg AAG J AGC AUG Met ACG Lys AGG J GUU GUC CUA Val GAU ASP GCU GACJ GCC FAla GGU] GGC CGA Gly CCA C CAA M UCAG Third letter UCAG UCAG First letter
The DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'
Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cys
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Use a codon chart determine the amino acid sequence. Remember to read through the strand and ONLY start after the promoter and STOP when it tells you to stop. Follow example below: Example: DNA AGA TATA TAC CTC CGG TGG GTG CTT GTC TGT ATC CTT CTC AGT ATC MRNA O protein AUG GAG GCC ACC CAC GAA CAG ACA UAG GAA GAG UCA UAG start-glu-ala-thre-hist - asp-glu-threo-stop met DNA CCT ATA TAC ACA CGG AGG GTA CGC TAT TCT ATG ATT ACA CGG TTG CGA TCC ATA ATC mRNA DGGA UAU) AUG uGul Gcc nccl cAul GCol protein ly Tur MeT cys AlA ser HIJ Ala 2 3 4 DNA AGA ACT ATA TAC CTC TTA ACA CTC TAA AGA CCA GCA CTC CGA TGA ACT GGA GCA mRNA protein DNA TAT ATAC CTT GGG GAA TAT ACA CGC TGG CTT CGA TGA ATC CGT ACG GTA CTC GCC ATC mRNA protein D DNA TAA ACT ATA TAC CTA GCT TAG ATC TAA TTA CCC ATC mRNA protein Auu UGA UAU AGU GAUCGA AUC MAG Auu AAU leu Stop. TRY-Met-Asp- ARG-Isle-Stop-Ile. Asn DNA CTA TTT ATA TAC TAG AGC GAA TAG AAA CTT ATC ATC mRNA protein D DNA CAT ATA TAC CTT AGT TAT CCA TTG ACT CGA ATT GTG CGC TTG…
Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′
A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following segment of DNA: GGCTAGCTGCTTCCTTGGGGA CCGATCGACGAAGGAACCCCT Note out the mRNA sequence generated by the template strant to produce that polypeptide chain Label each stran with its correct polarity (5' and 3' ends on each strand)
Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.
First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…