Translation of mRNA Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein). AUG AAA GGU CAC CCC TAG
Q: In peas, tallness is dominant over dwarfness, and red colour of flowers i dominant over the white co...
A: The terms dominant and recessive are defined by Gregor Johann Mendel. For each gene, there are two t...
Q: 1. Which is a more definite characteristic to show relatedness of two organisms? A. Similarity in de...
A: Since you have asked multiple questions , we will solve the first question for you. If you want any ...
Q: In this module, Dr. Anthony Hyman discussed two methods; RNA interference and mass spectrometry foll...
A: The term gene expression is associated with a cellular process involving genetic information pieces’...
Q: Plants are sessile. How are flowering plants so successful at reproduction in your own words
A: Flowering plants are the plants that use sexual mode for reproduction. The process involves flowers ...
Q: The Peruvian anchovy fishery occurs a highly productive region with coastal upwelling. Why is this f...
A: In a food web, this is an indicator of the effectiveness of energy exchange among trophic levels. It...
Q: With which type of reproduction do we associate the reduction division? Analyse the reasons for it.
A: There are two modes of reproduction mainly, sexual reproduction and asexual reproduction. In sexual ...
Q: What does the sodium-potassium pump do to reset and maintain resting potential? Inwhat sense is this...
A: Membrane transport is a term that refers to a set of mechanisms that control the passage of ions and...
Q: 1. Membrane proteins are key components of a typical cell membrane. Explain the importance of the pr...
A: Membrane proteins are part of or interact with cell membranes, and they are responsible for carrying...
Q: . Explain how you could test your osteoporotic and normal bone models to determine their strength. P...
A: Solution : Bone strength is determined by bone geometry, cortical thickness and porosity, trabecular...
Q: . Give an example of a phenotype and a gene or genes associated with it.
A: Given: Genetics is the branch of biology that deals with the study of heredity and variation. Father...
Q: Question 9 Match each section of a journal article with what you might find in that section. 1. Over...
A: References:- For a science fair project, a reference citation (also known as author-date citation) i...
Q: Pre-zygotic Reproductive Isolating Mechanisms Explanation Еxample Habitat Isolation Behavioral Isola...
A: Isolating mechanisms Factors that prevent gene exchange among populations are called isolating mech...
Q: e sex chromosomes the smallest chromosome in a karyogram? if not, the
A:
Q: What's More Activity 5.1 Directions: Match the following terms in Column A with their definitions in...
A:
Q: 19) During conjugation in Paramecium, and after the nuclei divide, the disappears: a) micronuclei b)...
A: ANSWER;- A) Micronuclei Explain;- During conjugation, the diploid micronucleus of each conjugant fil...
Q: Match the letters on the diagram below to the correct terms. 1. Glycoprotein E 2. Hydrophilic portio...
A: Introduction: Cell membrane is the outer covering of all cell but in plant cells, it is present belo...
Q: What are the general reasons of animals' existence in each era: Cenozoic, Mesozoic, and Paleozoic?
A: Coenozoic --- It took a catastrophic event to rid the planet of dinosaurs. Luckily for mammals, the ...
Q: ba saud əigissod au əg pinoɔ OUM Blood Types Blood type B Blood type O Blood type AВ Possible Parent...
A: Blood typing is a method employed to find out ones blood group. It is basically done so that a perso...
Q: 5' 3' C Process 1 5° Process 2 5 3'
A: Introduction Transcription:- Synthesis of mRNA from DNA template - Transcription is the process by w...
Q: 1. Many enzymes help in cellular respiration. Using the figure to the right, explain the difference ...
A: Enzymes are the bio-catalyst which increases the rate of the reaction. It binds to the substrate and...
Q: somatic cell
A: somatic cell is cell of the body except sperm and egg cells. Somatic cells are diploid cell that is ...
Q: List and explain the added advantages of multivariate analysis over bivariate analysis.
A: In an experiment, the study involving several measurements done on each unit and the relationship am...
Q: Which if the following would NOT result in speciation? a. a male bird changed its mating dance, ...
A: Speciation Development of a new species through a variety of factors. Rate of speciation depends on...
Q: Cellular Respiration 2 ATP 6 NADH 2 FADH 2 ATP 2 NADH 36 ATP ETHANOL MITOCHONDRIAL MATRIX MITOCHONDR...
A: Cellular respiration is a process by which chemical energy in the food is oxidized into energy in th...
Q: What are the difference of G, Q and R bands in karyotyping
A: Cells are the building blocks of life. Genes are the hereditary currency of life. Cells home various...
Q: what is the difference of FISH and karyotype?
A: FISH stands for Fluorescence In-Situ Hybridization. Karyotyping is a method of preparation of comple...
Q: Considering the Polymerase Chain Reaction (PCR), we can state that: a) It is a technique that promo...
A: Answer - a) It is a technique that promotes linear amplification of the number of DNA molecules in a...
Q: Cancer is a group of many different diseases that all are caused by... O Cells unable to exit the GO...
A: Cancer is a very complex and molecular disease that involves alternation of different molecules with...
Q: Sources of mutations exercise Match the mutational source type to the most likely description below....
A: This question based on mutation sources. A mutation is the changes of one or more gene that may caus...
Q: Why do scientists believe that mitochondria evolved before chloroplasts? A. because all eukaryotic c...
A: A cell is the basic unit of life. All living creatures are made up of cells, ranging from unicellul...
Q: Find i ection Its
A: Results When searching for sweets, American tend to prefer milk choclate over other cocoa choices. ...
Q: Tetrad analysis in Neurospora is described in Tool Box 6.1. In Neurospora, ser-6 is locate d to the ...
A: Crossing over occurs during prophase I and involves the exchange of genetic material between homolog...
Q: There is only one posSible sequence of amino се от атino acids when deduced form a given nucleotides...
A: The amino acid can be defined as the organic compound that comprises an amino group at one and a car...
Q: On your OWN opinion, what do you think abo the GMO corn that is
A: An animal, plant, or microbe whose DNA has been altered using genetic engineering techniques is refe...
Q: Please follow the arrows in order from top to bottom and match with the term that describes the indi...
A: Anatomy Anatomy is the branch of biology where the study of organisms organs and structure is done....
Q: 1. Describe how the phenotype of individuals with sickle-cell disease influences how common the Hbs ...
A: * sickle cell Anaemia is inherited genetic disorder in which the blood cells will attain sickle sha...
Q: we done an experiment where we extracted the DNA from strawberry, grape, and peas. With the strawber...
A: DNA extraction is the process of isolation of purified DNA by removing the other cellular components...
Q: 1. Which is a more definite characteristic to show relatedness of two organisms? A. Similarity in de...
A: Answer 1st question answer is Option D 2nd question answer is option C
Q: Learning Task 3: TRACE THE CODE dentify the amino acids coded for by the MRNA codon using the Geneti...
A: Codon Codon is a set of three DNA bases which code for amino acid.
Q: What is thought to be the correct sequence of the following events during the Carboniferous period? ...
A: Introduction :- Clubmosses, horsetails, ferns, gymnosperms (including conifers), and angiosperms are...
Q: Please answer fast Which of the following is the most effective antihelminthic immune response of m...
A: Helminthic infections are one of the leading causes of infections in humans. Nematodes and schistoso...
Q: suspected
A: Abstract Past research demonstrates a phenotypic relationship between childhood mal treatment and a...
Q: You've ordered and received your "primers" for your PCR. Now what? In your new role as an MLA your b...
A: A primer is a short, single-stranded DNA sequence which is used in the polymerase chain reaction (PC...
Q: Which of the following correctly describes a possible scenario during a run of gel electrophoresis w...
A: Agarose Gel electrophoresis(AGE) is a method used in molecular biology to separate mixed RNA, DNA, o...
Q: 2. Describe the phenotype of individuals whe inherit two copies of the Hbs allele whq Sickle-Cell Di...
A: * sickle cell Anemia a is blood disorder due to mutation will leads to change in shape of cells into...
Q: Why would a high energy transition state be favored when it requires more activation energy in an en...
A:
Q: If each agar plate contained 20 ml of LB agar and had an ampicillin concentration of 150 ug/ml, what...
A: Given data: Each plate contains- LB agar=20ml Ampicillin= 150 micrograms per ml. Amount of ampic...
Q: Which process or processes prevents UV radiation from causing cancer? A. MMR B. NHEJ C. HDR O D. Che...
A: UV radiation is a type of non-ionizing radiation emitted by the sun and man-made sources such as tan...
Q: When a homozygous plant that produces purple eggplants is crossed with a homozygous plant that produ...
A: Ans is.. 1 purple: 2violet: 1 white
Translation of mRNA
Using the codon chart provided, translate the following messenger RNA sequence into an amino acid sequence (protein).
AUG AAA GGU CAC CCC TAG
Trending now
This is a popular solution!
Step by step
Solved in 2 steps with 2 images
- Exploring the Structure of the 30S Ribosomal Subunit Go to www.pdh.org and bring up PDB file 1GIX, which shows the 30S ribosomal subunit, the three tRNAs, and mRNA. In the box on the right titled ‘Biological Assembly.� click “More Images.� and then scroll down to look at the Interactive Vic By moving your cursor over the image, you can rotate it to view it from any perspective. a. How are the ribosomal proteins represented in the image? b. How is the 16S rRNA portrayed? c. Rotate the image to see how the tRNAs stick out from the structure. Which end of the tRNA is sticking out? d. Where will these ends of the tRNAs lie when the 50S subunit binds to this complex?MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Amino Acid Code-End of the MRNA Codons* (anticodon) tRNA Alanine GCU Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid AGA AAU GAU UGU GAA Glutamine CAA Glycine Histidine GGU CAU Isoleucine AUU Leucine CUU Lysine Methionine AAA AUG Phenylalanine Proline UUU CCU Serine UCU Threonine ACU Tryptophan Tyrosine Valine UGG UAU GUA * There are 64 codons. Some amino acids have several mRNA codons. There is, however, no overlap of codes. 1. You should be able to fill in the 3-letter "code-end" of the tRNA molecules in the table above. Remember, in RNA A pairs with U, and G pairs with C. There is no thymine. Fill in the table.MRNA CODONS RESPONSIBLE FOR LINING UP EACH OF THE 20 AMINO ACIDS Code-End of the Amino Acid MRNA Codons* (anticodon) tRNA Alanine GCU AGA Arginine Asparagine Aspartic Acid Cysteine Glutamic Acid Glutamine Glycine Histidine AAU GAU UGU GAA CAA GGU CAU AUU CUU AAA AUG Isoleucine Leucine Lysine Methionine UUU Phenylalanine Proline CCU UCU Serine ACU UGG Threonine Tryptophan Tyrosine Valine UAU GUA There are 64 codons. Some amino acids have several mRNA codor There is, however, no overlap of codes.
- mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…Given the following codons and their corresponding amino acids: UUU-Phenylalanine GAA- Glutamate CAA- Glutamine AAU- Asparagine AAC- Asn AAA- Lysine UCU- Serine GGA-Glycine ACC-Threonine AUG- Met/ START codon CCU- Proline GUU- Valine UAU-Tyrosine UAA- STOP AGG- Arginine AUU- Isoleucine CAU- Histidine GCU- Alanine UGU-Cysteir GAU-Asparti CUA-Leucine UGG-Tryptol CGU-Arginin Box 1: Show the mRNA sequence which codes for the short peptide, lys-ala-phe- leu. Include what should come before and after this short message. Don't leave any spaces between the letters. Box 2: Show the tRNA anticodon sequence that would line up with the mRNA strand from Box 1. Don't leave any spaces between the letters. Box 3 & 4: Show the DNA base sequence that would be found in the DNA double helix which carries the gene for this peptide. Give the coding strand sequence in Box 3 and template strand sequence in Box 4. Don't leave any spaces between the letters. Box 5: What if there was a frameshift at leucine…READ INSTRUCTIONS WND COMPLETE MRNA CODON COLUMN
- Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)Write the sequence of the mRNA molecule synthesized from a DNA template strand having the sequence 5'-ATTACAGGCGGT-3' 5'- UAAUGUCCGCCA Incorrect Write the amino acid sequence encoded by the mRNA base sequence 5'-GAGUUAGUUUGUAAGUGC-3' Assume the reading frame starts at the 5' end. Refer to the codon table . Amino acid sequence: Glu-Leu-Val-Cys-Lys-Cys What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free protein-synthesizing system that does not require a start codon? Enter an amino acid sequence of four amino acids using the three-letter abbreviations. Polypeptide sequence: Poly( -3' Glu-Leu-Val-Cys-Lys-Cysotein structure urs Chaperones AUG Zwitterion Tarm Aminoacyl-tRNA synthetase Unanswered 0 0/1 answered III I III A compound with no electrical charge made up of separate molecules with positive and negative charges that balance each other out. Attaches the appropriate amino acid to a tRNA molecule based on its anticodon. Surprisingly contains a thymine in it despite being a piece of RNA. Recognized by the anticodon UAC. Small group of proteins that assist protein folding. Submit
- Suppose that a protein has the amino acid sequence Met‑Tyr‑Asn‑Val‑Arg‑Val‑Tyr‑Lys‑Ala‑Lys‑Trp‑Leu‑Ile‑His‑Thr‑Pro A researcher plans to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Her probes should be exactly 18 nucleotides in length. Consult the codon table. Select which amino acids in the protein should be used to minimize degeneracy when designing the probes. Val‑Tyr‑Lys‑Ala‑Lys‑Trp Met‑Tyr‑Asn‑Val‑Arg‑Val Arg‑Val‑Tyr‑Lys‑Ala‑Ly Trp‑Leu‑Ile‑His‑Thr‑Pro Calculate the number of different probes that must be synthesized in order to determine the exact cDNA sequence that specifies the region of the protein selected. number of probes:Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′Refer to the information on the genetic code. Use this information to determine how many amino acids are coded for by the mRNA sequence AUGCGCAGUCGGUAG. The genetic code Second letter of codon UAU UAC JUU Phenylalanine uCU UUC Phe) UUA Leucine (Leu) UUG Tyrosine (Tyr) GCysteine (Cys) UGC 1oStop codon |UGG Tryptophan (Trp) CGU CGC UcC Serine (Ser) UCA ucc CCU cC Proline (Pro) Stop codon UAG Stop codon CAU Histidine His) CU CUC CUA CUG Arginine (Arg) Leucine (Leu) cca CAA CCA CGA Glutamine (Gin) CAG AUU AUC AUA ACU Isoleucine (le) AAU AAC AGU AGC Asparagine (Asn) Serine (Ser) ACC Threonine (Thr) ACA Methicnine ACC start codon GCU Lysine (Lys) AGA Arginine (Arg) ARC AGS GAU Aspartic acid (Asp)G0 GAC GUU GUC Valine (Val) GCC Alanine (Ab) GG Glycine (Gly GUA GUG GCA GCG GA Glutamic acid (Glu) GA GGG GAG 4 15 First letter of codon Third letter of codon
