D. Evaluation (Pagtataya) • Fill in the pill-shaped bubbles in the flowchart using the terms in the box below. mino acid nuclear pore TRNA anti-codon transcription MRNA codon translation posome MRNA nucleus TRNA The 1* step of protein synthesis is Takes place in the Where DNA is decoded into 1. transcription 2. nucleus 3. Which then leaves through the The 2nd step of protein synthesis is 5. And attaches to a Where 4.
Q: ch as the heart beating and consuming oxygen. at 52.5 ml/kg/min. How many METS is she working at? Fg...
A: 37..The statement is false Resting metabolic rate is the amount of energy present at rest. BMR- ba...
Q: Collecting data that can then be transformed into a bacterial growth curve is usually done using a s...
A: A spectrophotometer is an instrument used to measure the amount of light absorbed by a sample. The m...
Q: 1. Which of the following would best determine whether two flower species share a recent common ance...
A: Evolution is the change in characteristics of species from one generation to another. Theory of evol...
Q: What is the relationship between BMR and body size? Why?
A: Basal metabolic rate:- Basal metabolic rate is the rate of energy expended at rest in a neutral envi...
Q: In a resting neuron, there are more ions inside the cell and more ions outside the cell. sodium; pot...
A: Introduction :- The voltage across a cell membrane during the resting stage is known as the resting ...
Q: An organism's relative fitness is measured by its Genetic variability Mutation rate Contribution to ...
A: Relative fitness is a method of evaluating the number of offspring produced by individuals within a ...
Q: Explain the 3 stages of cellular respiration. Why is ATP so important?
A: Each and every organisation is madeup of cells, the unit of life. The organism is unicellular or a m...
Q: Immature B cells can drive strong adaptive immune responses by maturing into _______. Group of answe...
A: There is some information about B cells ; B cells are at the centre of the adaptive humoral immune s...
Q: What is the best description of tRNA (transfer RNA)? Question 15 options: It temporarily stores...
A: Transfer RNA is a short RNA molecule that aids in the production of proteins. A trinucleotide region...
Q: Which of the following is NOT an intermediate filament? A. keratin B. titan C. nuclear l...
A: Intermediate filaments:- Intermediate filaments are very stable structures that form the true skelet...
Q: Two scientists calculated the membrane potential of a neuron using two different equations, the Nern...
A: The membrane potential is the difference in electrical charge between the inside and outside of a ce...
Q: The is responsible for homeostasis and the coordination of the nervous and endocrine systems. O midb...
A: Introduction :- The endocrine system, which is made up of all of the body's hormones, regulates all ...
Q: Chose the incorrect statement from below. Select one: O a. Protein stability and subsequently benton...
A: with increasing alcohol content, protein stability does not increase.
Q: When sarcomeres contract during muscle contraction, which of the following occurs? A. The myosin...
A: Sarcomeres contract during muscle contraction.
Q: If there are 32 sister chromatieds in a normal somatic cell, what is the haploid number for that cel...
A: Chromosome are the string like structure that comprises of DNA , histone proteins as well as heredit...
Q: Centrioles at opposite end of cell Spindle fibres attached to centromeres 46 double stranded chromos...
A: Metaphase - is the stage of cell cycle where condensation of chromosomes occurs. This is the stage o...
Q: In which of the following cases would treating a patient with an antiserum (purified antibodies) be ...
A: The administration of anti serum also called as antitoxin or purified antibodies is a form of passiv...
Q: Write an introduction of the isolation and purification of bacteriophage with host Escherichia coli
A:
Q: A strain of E.coli harbors a temperature sensitive mutation where cultivation of the bacterium at lo...
A: Here the correct Statement would be MOMP accumulation in the outer membrane will be high , MOMP is ...
Q: Human cytochrome c and chimpanzee cytochrome c are identical in all 104 amino acids. Our close relat...
A: Human and chimp DNA is so comparable as the two species are so firmly related. People, chimps and bo...
Q: Besides the XY system, are there other sex determination systems?
A: XY system of sex determination is found in humans. In humans, males are heterogametic sex and femal...
Q: Mitosis differs from meiosis in that only mitosis: O is preceded by interphase involves two successi...
A: Introduction: Cell division is the means of reproduction in which all cells need to copy their chrom...
Q: Describe at least three to five other limiting factors (other than the number of predators or prey) ...
A: Describe at least three to five other limiting factors (other than the number of predators or prey) ...
Q: Arcuate Artery Arcuate Vein Collecting Tubule 10 Distal Convoluted Tubule Afferent Vessel 11 Efferen...
A: * nephrons are functional unit of the kidney, the structures that produces urine removing waste and...
Q: Which of these innate defenses would be most inhibited by antibiotic use? Group of answer choices Mu...
A: Innate immunity is the one that is present since birth. It helps in protection against all antigens.
Q: Why do some, if not most aquatic organisms, have supplemental respiratory organs as compared to stri...
A: Aquatic animals are those who live in water and have special respiratory system. Terrestrial animal...
Q: STRUCTURAL STRUCTURAL DEVELOPMENTAL SIMILIRATIES WITH UNIQUENESS PATTERNS DNA OTHER ORGANISMS MILKFI...
A: Polar bears live in the Arctic, on waters. Polar bears depend on ocean ice to get to the seals that ...
Q: Bacteria can best survive low pH and dryness by producing ____________. Group of answer choices Endo...
A: Introduction :- Bacteria have cytoplasm, ribosomes, and a plasma membrane, just like eukaryotic cell...
Q: 3. Cross a homozygous Blue Parakeet with a homozygous Yellow Parakeet. What is the genotype and phen...
A: Genetics is a branch of biological sciences that studies genes, genetic variation, and heredity in l...
Q: Protocols for analysing DNA
A: *DNA can be analysed through Polymerase chain reaction Short tandem repeat analysis Y chromosome a...
Q: Discuss the flaws that should be identified and addressed throughout the cell morphology method's ch...
A: Cell morphology describes size, shape and structure of particular cell.
Q: Explain why loss-of-function hedgehog and smoothened mutations yield the same phenotype in flies, bu...
A: The Hedgehog signalling pathway is responsible for transferring information to embryonic cells. Thes...
Q: Volcanic ash can be used to date fossil finds because each time it is expelled by an eruption it has...
A: The answer is True
Q: Which of the following options is the correct genotype ratio for this cross? The cross is a female w...
A: "Genetics" is the study of the functioning and main codes of variation and heredity. Inheritance is ...
Q: EXPLAIN why it is false. The only way to open an initial channel on a cell is to give it a ligand/si...
A: The only way to open an initial channel on a cell is to give it a ligand / signal. Correct Answer: ...
Q: The number of bacteria in a sample can also be quantified with other techniques, such as examination...
A: In microbiology laboratories the number of microorganisms present in a particular sample is determin...
Q: Referring to the figure below, explain why NADH yields more ATP than FADH2 does. Electron-transport ...
A: The electron transport chain is a combination of four protein complexes that connect redox processes...
Q: What process must be completed before a cell begins the process of division? O The somatic cell must...
A: Introduction :- Cell division results in the formation of new cells. A single cell divides to prod...
Q: What part of the brain can sometimes be referred to as the “rind” or outer covering? a. thalamus c. ...
A: The nervous framework is the major controlling, administrative, and conveying framework in the body....
Q: Elaborate how cryoprotectant protect cells from freezing injury.
A: Freezing cells, maybe animal cells or plant cells, is done to preserve cells for a long period of ti...
Q: Identify the parts of the cortex that process the different senses and those that control movement o...
A: The nervous framework is the major controlling, administrative, and conveying framework in the body....
Q: Q2:Skeletal analysis of Neanderthals suggest that they were physically adapted to cold weather envir...
A: INTRODUCTION Neanderthal man They are extinct species of moder human. They are seen in Eurasia about...
Q: Explain the relationship between light dependent reaction and calvin cycle.
A: Photosynthesis is the process by which green plants use sunlight, water and carbon dioxide to create...
Q: Photosynthesis can be impacted by shifts in environmental conditions, most notal by high light inten...
A: The three fundamental sorts of photosynthesis are C3, C4, and CAM (crassulacean corrosive digestion)...
Q: Charles Darwin developed his theory of natural selection without understanding the nature of genetic...
A: Charles Darwin gave one of the most solid theory of evolution He proposed that the natural selectio...
Q: Which of the following is NOT an evidence for Darwin's theory of common descent? Group of answer cho...
A: Darwin's theory of common descent is idea that defines species change overtime giving rise to new sp...
Q: Questions:- 6. In prokaryotes, which DNA polymerase is primarily responsible for filling in the gap...
A: NER (nucleotide excision repair) is a critical DNA (deoxyribonucleic acid) repair mechanism. It is u...
Q: Diagram showing the evolution of a domesticated crop
A: Domestication of crops is a strategy that involves the process of artificial selection of plants in ...
Q: The infoldings of the chloroplast and mitochondria were discussed. The same phenomenon happens in th...
A: The infoldings in the mitochondria increase the surface area for the recruitment of respiratory enzy...
Q: Who is the French biologist best known for the Theory of Acquired Inheritance? Group of answer choic...
A: Answer is Jeans Baptiste de Lamarck
please answer the number without answers
Step by step
Solved in 2 steps
- 12 > Macmillan Leaming Consider the image of protein synthesis (translation). Identify the two different RNA molecules involved in the process, as well as the amino acids being produced. madbou God Tyr mRNA Aip Anwer Bank 3 Ma Arg IRNA Th Ala AttemptD. The sequence of a eukaryotic gene is given below, where in boed an inset containing: 5'GA TTATGGAATTCACCTAT GATCGCAT GGCCATTGAACCT 3 3CTAATACETTAAGTGGATA CTAGCGTA CCGGTAACIT GGA 5 A. Write the sequence of the WRNA produced by its process of transcription and of wRNA that is transferred to ribosomes in order to produce the peptide B. A mutation has occured in the above gene. The GIC pair highlighted replaced by T/A. Cells that are homozygous for that mutation become Cancerous. Do think this gene is a you proto-oncogene? or a tumor suppressor gene and why? describes D₂. The following family tree is given which the way inheritance of a dease. It is noted that only one of its two persons generation I is heterozygous and that one of the individuals in subsequent generations exhibits unexpected Phenotype. Individuals II4 and III2 show its phenotype disease. The remaining individuals have normal phenotype. αBONUS: In Bacteria, recognizes the Ribosomal Binding site on mRNA and catalyzes formation of peptide bonds during translation (answers must be in correct order) O aminoacyl tRNAses; aminoacyl TRNA synthetases ribosomal protein translation factors; ribosomal protein initiation factors O helicase; gyrase O 165 rRNA; 23S rRNA
- A. In transcription, a region of DNA opens up. One strand, the template strand, serves as a template for synthesis of a complementary RNA transcript. The other strand, the coding strand, is identical to the RNA transcripf in sequence, except that it has uracil (U) bases in place of thymine (T) bases. Given the following piece of messenger RNA (MRNA): CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCC... Answer the following questions. 1. List the complementary non-coding DNA sequence. This refers to the template strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 2. List the DNA strand sequence complementary to the template strand. This refers to the coding strand. (Please insert a space every after three letters for easy checking of your papers. Thank you.) 3. List the amino acid sequence of the protein coded for. (Please insert a space every after one amino acid for easy checking of your papers. Thank you.)Transcription and Translation For the following strand of DNA, show me the messenger RNA strand and the transfer RNA strands. I have only drawn the coding strand of DNA. DNA: I LATACCGAATTIACGC CCCAA ATTCTIGAGC CATC. Deepen (Pagpapalalim ng Kaalaman) Let us do the activity below. (50 mins. with provision for analysis and writing your answers) PERFORMANCE TASK-SAY IT WITH DNA: PROTEIN SYNTHESIS Directions: 1. Build the correct mRNA molecule by transcribing the template DNA strand. 2. Figure out the TRNA triplets (anti-codons) that would fit the mRNA triplets (letter by letter). 3. Translate the MRNA codons and find the correct amino acid using the Codon Wheel on page 1. 4. Write in the amino acid (abbreviation) then, record the one-letter symbol of the corresponding amino acid. If you do this correctly, the symbols should spell out a meaningful message in English. Note. "Stp" = "space" (no equivalent symbol, leave it blank) MRNA DNA -> TRNA T А U G A -> A -> Here is a partially solved message... Decode the rest of the message. TT CTT DNA message code CTT | GGG ACT TAG AGC ATT CCT GCC CTT CGA TGC MRNA CUU AUC UUU GAA UGA AUC TRNA GAA UAG AAA CUU ACU UAG Amino Acid abbr. (based on MRNA) Leu Ile Phe…
- IV - COMPLETION: Complete the table below, supply the viven DNA template to its correct pair and give the correct codon and amino acid using the codon chart. DNA ATG UUG ACG GCA TAG DNA MRNA FRNA Amino AcidII. Use the eukaryotic gene DNA sequence below to answer the following questions: 1 11 CGACTTACTG 51 TGGACGCGCC 101 Genetic Code: First letter U с c. Where is the 3' UTR? Circle one. 70-111 14-60 C Polyadenylation signal in the corresponding mRNA: Kozak's sequence in the corresponding mRNA: Start (initiation) codon in the corresponding mRNA: Stop (termination) codon in the corresponding mRNA: UUU UUC UUA UUG] CUU CUC CUA CUG 61 AUU AUC AUA AUG لالا GUU GUC GUA GUG GGCGTATAAA GCGACGACTG TAGACTGATG AGCCTATCCA 111 GTCATTCAGC GTAGTCTGAT GCCAGTCGAC TGCATTGGAC ACCGGTTACA a. Write the corresponding sequences, circle & label them in the sequence above: TATA box sequence: (label as TATA) U ATGGCCCTGT AAGCGGTGCG ATGCAATAAA b. What region of mRNA contains the open reading frame that will be translated into protein? Circle one. 51-111 Phenylalanine. (Phe) Leucine (Leu) Leucine (Leu) Isoleucine (Ile) Methionine (Met) 21 61-69 Valine (Val) 71 UCU UCC UCA UCG CCU CCC CCA CCG 121 ACU ACC ACA ACG GCU…ACTIVITY: Transcribe mel A. Below is a DNA sequence. Write the sequence of MRNA codons that would result from the transcription of the DNA sequence. 4 CTT 6. ACG 7 GGG 8 AAC 10 ATT DNA: ACA ATA TAG TTG CC MRNA: B. Rewrite your mRNA sequence from part A. Using the amino acid chart, determine the sequence of amino acids based on your mRNA strand. Use hyphens (dashes) to separate amino acids. mRNA: RNA:
- Name: Clas: Date: Transcription 3" ATGACGGATCAGCCGCAAGOCGGAAfTGGCGACATAA UACUGCCUAGUCGGCGUU 3 5' WA WAW TACTGCCTAGTCGGCG TCGCCTTAACCGCTGTATT 3' 6 Label the diagram as you read the following passage. Transcription is the process cells use to copy information from DNA into messenger RNA copies. Part of the chromosome's tightly wound-up long strand of DNA is "loosened" to allow for RNA polymerase room to copy part of the DNA. Think of this as opening a page out of a giant book with thousands of pages to make a copy of just that one page. One side of the DNA strand is the template strand (or anti-sense strand) and is used by an enzyme called RNA Polymerase to create the messenger RNA. RNA Polymerase is directed by a bunch of proteins called transcription factors to the spot it needs to start copying. RNA Polymerase reads the template strand from the 3' end to the 5' end and creates a messenger RNA strand that is complementary to the template strand. In the diagram above, you can see that…Direction: Study the given amino acid sequence and DNA sequence of the Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-LEU-LEU-SER What's More Activity 3.1 Check and Relate listed organisms. Cat DNA Sequence: TTAATCCCCCCGTTTATCCTACTTTCCCATCTACTAAGT Am no Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-EU-SER-ARG-LEU-LEU.AD DNA Sequence: CTTATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Shark Amino Acid Sequence: LEU-ISC-PRO-PRO-PHE-ILE-LEU-LEU-SER-HIS-VAL-VAL-SER DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCATGTAGTAAGT Colphin Amino Acid Sequence: LEU-ISO-PRO-PRO-PHE-LE-LEU-LEU-SER-ARG-LEU-LEU-ARG DNA Sequence: CTAATCCCCCCGTTTATCCTACTTTCCCGTCTACTTCGT Lizard Amino Add Sequence: ISO-4SO ASP-GLN-PHE-ILE-LEU-HIS-SER-ARG-LEU-LEU-ARG DNA Sequence: ATTATCGACCAGTTTATCCTACATTCCCGTCTACTTCGT Sponge Activity Questions: 1. Which organisms are closely related to each other? How are they related? 2. What does this tell us about the organisms and their ancestors? 3. How amino acid sequences and DNA…Content C b. Biol 1406-Lec 17 Gene Exp X acconline.austincc.edu/ultra/courses/_891351_1/cl/outline Blackboard Learn q Which of the following statements about gene regulation is not true? O RNA interference is the inhibition of mRNA translation by siRNA's or miRNA's literally blocking access to the mRNA transcript or causing it to degrade. O X GWhich of the following staten X QUESTION 8 Paraphrasing Tool - QuillBot Al x Your disk is almost full Save space by optimizing st Alternative RNA splicing in eukaryotes can produce many different polypeptides from a single mRNA sequence by interpreting differing mRNA segments as introns or exons and splicing them accordingly. O DNA methylation can reduce or halt DNA transcription as DNA is negatively charged and the added methyl is negatively charged causing the methylated DNA to supercoil becoming inaccessible to RNA polymerase. O Some operons such as the lac operon can be controlled through both positive and negative gene regulation. O…