Ôn the space provided, type the translation product of wild-type gene A (use three- letter abbreviation for the amino acids; use - to indicate a peptide bond). 5' CTAATCGCCTAATCCGCTTGCGGCCAT 3'
Q: Please help me find the protein sequence in reference to the text below. "mRNA Sequence…
A: Cell is the basic structural and functional unit of life. The nucleus in the cell contains the…
Q: For the following mRNA sequence (reading from left to right) what will be the amino acid sequence…
A: Genetic code consists of four letters 'GACU' which stands for guanine, adenine, cytosine, and uracil…
Q: what is the c-terminal AA residue? use one-letter code for amino acid
A: The amino acid can be defined as the organic compound that comprises an amino group at one end and a…
Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…
A: Central dogma is the process where in the information stored in nucleic acids is transferred to…
Q: rom the mRNA base sequence CUU-AUG-GCU-UGG-CCC-UAA A.What anticodon sequences of tRNA’s are coded?…
A: Anticodon- It is a sequence of three ribonucleotide on tRNA , which is complementary to a codon on…
Q: Listed below are five amino acids. Use the genetic code to determine the exact codon for each amino…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: The template strand of wild-type gene A is shown below. On the space provided, type the translation…
A: Amino acids are known as the building blocks of protein. They are required for the synthesis of…
Q: Which of the following represents the sequence of an RNA transcript for which the template strand of…
A: The deoxyribonucleic acid (DNA) is the nucleotide sequence that stores the genetic information of an…
Q: m
A: DNA → RNA RNA → protein
Q: A portion of a strand of a much longer molecule has a nucleotide sequence of AGCAGGCAGATC. During…
A: Translation, in molecular biology and genetics, is the mechanism by which ribosomes in the cytoplasm…
Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…
A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…
Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…
A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…
Q: If the DNA sequence is 3’ ATCGACGTC 5’, what is the mRNA sequence
A: DNA is the double helix structure. Two complementary strands present in the DNA. The direction of…
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: The process of gene expression involves the process of transcription followed by the process of…
Q: Second letter UUU Phenyl- UUC alarine UGU UGC Cysteine UAU UCU UCC UCA UCG UAC yrosine Serine UUA…
A: Mutation of amino acids change the primary structure of the protein which affects the protein…
Q: The template strand of wild- type gene A is shown below. On the space provided, type the translation…
A:
Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…
A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…
Q: Write the amino acid for the codons below 5'-AUG UUC CAG CUA GAU GAU AUG CUG GUA AUU GGG GAA CGC…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…
A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…
Q: Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply…
A: The process of translation in involves three steps - (A) Initiation: it involves binding of a small…
Q: Second base of codon U A G UCU Phenylalanine UAU UUU UGU Cysteine U Tyrosine tyr y UUC phe F UCC UAC…
A: A) The Adenine (A) is present in the intron or non-coding part of the gene, transcription results in…
Q: Which of the following represents the sequence of an RNA transcript for which the coding strand…
A: A DNA molecule is a double-helical structure.
Q: EF-Tu: EF-Ts as ORF-1:RF2 eEF1A:eEF1B O Shine-Dalgarno:5'-7mG O Co-translation: post-translational…
A:
Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…
A: During transcription process RNA is formed with the help of complementary base pairing with template…
Q: Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
A: The ribonucleic acid (RNA) molecule involves the transfer of the genetic information from the…
Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…
A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…
Q: Define the following terms as they apply to the genetic code:a. Reading frameb. Overlapping codec.…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Given this sequence: AUG TAT ACC GAG, which of the following would result in a frameshift mutation?…
A: The sudden, inheritable, and stable alteration in the genetic material is said to be a MUTATION. The…
Q: Consider the mRNA sequence below. Assume that the following mRNA segment has been translated.…
A: Francis crick proposed the central dogma, which states that the DNA is replicated. This DNA is used…
Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…
A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…
Q: For each mutant, state what change has occurred in the DNA, whether it was a substitution by…
A: CODONS 3 4 5 6 7 8 9 NORMAL PRO THR VAL THR THR ARG TRP CODON CCC ACG GUG ACG ACA CGG UGG…
Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…
A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…
Q: AAAGAGAAAAGAAUA to AAAGAGAAAUGAAUA. Suppose the codon sequence has a single base pair mutation If…
A: Introduction: Mutations are changes in the genetic material or character of an organism. It can…
Q: A Section of a Gene TGC GTG TAC CTA CCA For the DNA sequence shown above, identify the following:…
A: The given DNA sequence is as follows, TGC GTG TAC CTA CCA
Q: Codon to be read in the mRNA is 5' GAA 3', what is the amino acid? a. E b. K c.F d.L
A: Dear student answer of your question is given below: Given codon in the mRNA is 5' GAA 3' , It…
Q: Using the codon charts in your text (section 6.1), fill in the chart below. [ /8] Original DNA…
A: The gene expression in the cells is brought about by the various processes of Replication…
Q: Assume that the following mRNA segment has been translated. 5’-UACCGAAUGUCU-3’ Note for…
A: Translation is the process during which codons in mRNA are identified by tRNA with specific…
Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation? *…
A: The process of formation of a polypeptide sequence from an mRNA transcript is known as translation.…
Q: The following DNA strand is bound to transcription and translation. Give the translated 5-letter…
A: The nucleic acid polymer has nucleotide as its monomeric unit. synthesis of nucleotide…
Q: he anticodon for the codon GCA is:
A: CENTRAL DOGMA- Replication is the process when DNA replicates itself means it will make copies of…
Q: The images shown depict the initiation and elongation steps in protein translation. Arrange the…
A: The amount of mRNA which is define with the mechanism that is usually produced by a gene is limited,…
Q: Use the first picture and codon table to answer the following questions.
A: The exons are the coding portions of the gene and introns are the non-coding portions, which need to…
Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…
A: AAG ATA CAG GCT CGG TAA : DNA
Q: Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence:…
A: So the given m-RNA code for - met-glu-ser-leu-leu.
Q: Define the following terms:a. codonb. anticodonc. genetic coded. open reading framee. codon usage…
A: Molecular genetics is a sub-field of biology that addresses how differences in the structures or…
Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…
A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…
Q: Following the 5-> 3' conversion of writing nucleotide sequence, indicate which of the following MRNA…
A:
Q: Use the codon chart to translate the following MRNA transcript into a protein. Please format your…
A: The synthesis of proteins with the help of m RNA is know as translation.
Q: The following sequence is from the template strand of a bacterial gene, and it includes the…
A: According to the central dogma of the molecular theory, the information stored in DNA is first…
Q: AAC (DNA TRIPLET) = _______(mRNA CODON) = _________ AMINO ACID 2. TCG (DNA TRIPLET) = _______ (mRNA…
A: Transcription:- process of conversion of DNA to mRNA. Translation:- process of conversion of mRNA…
Step by step
Solved in 2 steps with 2 images
- 5'-TAGCTGATCGAATATGCGGTCTCTATCTTCGTAGACGA-3' 3'-ATCGACTAGCTTATACGCCAGAGATAGAAGCATCTGCT -5' Determine the amino acids that will be encoded by this sequence Second letter First letter U C A G U UUU Phe UUC UUA UUG Leu CUU CUC CUA CUG Leu GUU GUC GUA GUG Val UCU UCC UCA UCGJ AUU AUC lle AUA ACA AUG Met ACG CCU CCC C CCA CCG ACU ACC GCU GCC GCA GCG Ser - Pro Thr Ala A UGU UACTyr Cys UGC. UAA Stop UGA Stop A UAG Stop UGG Trp G CAC His CAA Gin CAG GAUT GAC Asp GAA AAU Asn ACC Ser AGU AAG LYS AA Glu GAGJ Oa. N-Met-Arg - Ser-Leu-Ser - Ser-C Ob. N-Met-Pro-Arg - Asn-Asp - Ser-C d. N-Met-Lys - Val-Glu-Ala-C Oc. N-Asp-Pro-Lys - Ser - Val-Ile-C Oe. N- Met-Ala-Asp-Pro-Lys - Ser-C G CGU CGC CGA CGG AGA AGG. GGU GGC GGA GGG Arg SCAO Gly U UCAG UUA DUAG Arg G Third letter 13First Letter A G U с 22. Using the provided "Genetic Code-Reference" answer the following question. Based on the following DNA template strand, write out the amino acid chain produced. 23. Consider the following mRNA base codon sequence 5'-AUC-GAA-3' and the provided "Genetic Code-Reference". Genetic Code-Reference UUU UUC UUA UUG CUU CUC CUA CUG (mutated or silent) (mutated or silent) b. Briefly explain your reasoning for each. (be sure to include both parts) AULLY AUU a. Label which of the following would result in a mutated amino acid sequence or a silent mutation. (May help to first determine the original amino acid sequence, then compare to mutations) U Phe mRNA codon sequence: anticodon sequence: amino acid sequence: Leu Leu 5'-AUA-GAA-3' Val 5'- AUC-GAC-3' AUC Ille AUA AUAJ *AUG Met/Start GUU GUC GUA GUG UCU UCC UCA UCG) CCU) CCC ccc CCA 000 CCG ACU ACU ACC ACA ACG, C GCU GCC GCA GCG Second Letter Ser Pro Thr 3'-CAA-GTC-TGT-5' Ala UAU UAC) Tyr Туг A **UAA Stop UAG Stop CAU] CACJ…5'GGT ACG TTG GGG CTC CAT3' This sequence is transcribed and translated. Write the resulting amino acid sequence using the 3 letter code. Write the answer in a all capital letters. Leave a space between the amino acids. Do not write 5' and 3'.
- mRNA Codon Chart: Second letter с บบบ UCU UAU Phe UUC UCC U Ser UAC Tyr UGU UGC Cys UUA UCA Leu UAA Stop UGA Stop A UUG UCG UAG Stop UGG Trp CUU CCU CAU CGU CUC CCC His CAC Leu Pro CUA CCA CAA CGA Arg Gin CUG CCG CAG CGG AUU ACU AAU AUC lle ACC AAC AGU ]Asn Ser AGC A Thr AUA ACA AAA Lys AGA Arg AUG Met ACG AGG GUU GCU GAU GUC GCC Val GAC Asp GGU GGC Ala GUA GCA GUG GCG GAG GGG GAA Glu GGA Gly Amino Acid 3-Letter Codes Name of Amino Name of Amino 3-Letter Code 3-Letter Code Acid Acid Alanine Ala Leucine Leu Arginine Arg Lysine Lys Asparagine sex Methionine Met (start) Aspartic Acid Asp Phenylalanine ebe Cysteine Cve Proline Pro Glutamic Acid Glu Serine Ser Glutamine Gln Threonine Glycine GLK Tryptophan JAR Histidine His Tyrosine Tyr Isoleucine lle Valine Val Exercise: Transcription & Translation 1. Choose 3 DNA Templates. 2. Write the mRNA sequence divided into 3 letter codons. 3. Write the sequence of amino acids. 4. Find the corresponding amino acid sequence and include the letter of…Given the genetic code below, enter the correct amino acid sequence for the following RNA sequence: AUG GAG UCC UUG CUG UGA (enter the amino acids as the 3 letter abbreviation on the table separated by dashes with no spaces e.g. Met-Thr-Lys-Glu-Ser) Alanine (Ala) AGUC Tyrosine (Tyr) Valine (Val) GU Cysteine (Cys) START HERE G Arginine (Arg) G Tryptophan (Trp) A C CUGA Serine (Ser) Leucine (Leu) Lysine (Lys) Proline (Pro) Asparagine (Asn) 0406 ACUGACUOROE (na) auone (aug) Giycine (Gly) Serine (Ser) Phenylalanine Glutamic acid (Glu) Aspartic acid (Asp) Histidine (His) Glutamine (Gin) Arginine (Arg) Isoleucine (lle) Methionine (Met) o Threonine (Thr)5' UGG CAA UCC UAC GAU 3' - 1. Here is the MRNA sequence from a section of a gene (it is the middle of the sequence, so it has no AUG). What is the template sequence of this gene? - 2. Are any of these codons in the MRNA non-degenerate? If so, indicate which one. e 3. 4 a) Translate this mRNA section. Give the 3 letter codes for the amino acids. b) Indicate on the peptide which is the C terminus and which is the N terminus. e 4. Is it possible for a single base pair substitution to cause a truncation in this peptide? If so, e explain how. e 5. Write out the sequence of the anticodon in the tRNA that would bind to the fourth codon in the e MRNA. e 6. Write out a possible miRNA that could regulate the expression of this gene
- Given the following DNA sequence: 3'-TACTTNGTNCTNTCN-5' where N stands for any nucleotide, give the complementary mRNA sequence. Indicate direction of strand as 3'--> 5' or 5'--> 3' as in the given sequence above. Give the amino acid sequence of your mRNA sequencelin No. 1. Indicate direction of strand as above. Use all lowercase letters, 3-letter name of amino acid separated by a hyphen (-), no spaces in-between.First letter U UUU Phenyl- UUC alanine Leucine UUA UUG CUU CUC CUA CUG AUU AUC Isoleucine AUA AUG GUU GUC Leucine GUA GUG Methionine; start codon Valine Normal, wild-type sequence A. mutation I mutation A UCU UCC mutation C UCA UCG mutation B CCU CCC CCA CCG ACU ACC ACA ACG GCU GCC B. mutation II C. mutation III Point mutations are underlined. GCA GCG Second letter Serine Proline Threonine Alanine UAU UAC Tyrosine UAA Stop codon UAG Stop codon CAU CAC CAA CAG AAU AAC Histidine Glutamine Asparagine AAA AAG Lysine GAU Aspartic GAC acid GAA Glutamic GAG acid G UGU UGC Cysteine UGA Stop codon A UGG Tryptophan G CGU CGC CGA CGG AGU AGC AUG UCU CGG GCU UAC AUA UCU CGG GCU UAC AUG UUU CGG GCU UAC AUG UCU AGG GCU UAC GGU GGC AGA AGG Arginine GGA GGG Arginine Serine UOAGUO AGUOAGUCAG Glycine Which mutation would result in a conservative substitution with potentially serious consequences to the translation of the mRNA and synthesis of the protein? Third letterSecond letter A UUU UCU) UC UCA UCG UAU UUC Phe UUA Tyr UGU UGCJ Ser UAA Stop UGA Stop A UAG Stop UGG Trp UUG Leu CAUHIS CUU CUC CUA CUG CCU* C ССА CCG CGU His САС Leu CGC Arg CGA Pro CAA Gin CGGJ Gln Which amino acid is carried by the TRNA with the anticodon 5'-UCA-3? ACU ACC ACA AAU AAC. AGU AGC AGA AUU Ser Asn AUC Ile A AUA Thr AAA Lys AAG Lys AGG Arg AUG Met ACG GAU GGU] GUU GUC GUA GUGJ GCU GCC GCA GCG GAC Asp Ala GAA GGC Gly GGA Val GAG Glu GGGJ Isoleucine. None-this is a stop codon. Aspartic acid. Histidine. IV. Leucine O V. Third letter UCAG UCAG UCAG First letter
- For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and translate the sequence using the genetic code provided below. 5' - AAUUAUGGGCAAUAUGCCGGGCcGGUUAAGCG - 3' Second Letter A UGU cys u UGC Phe UCU UU U UUC UUA UAU Tyr Ser UAC UAA UAG Leu UCA Stop UGA Stop UUG UCG Stop UGG Trp CUU CU CAU His CGU c cuc Leu ccc ССА CCG Pro CÁC CAA CAG CGC CGA CGG Arg CUA CUG Gin 1st 3rd letter Ser u letter AUU ACU AAU AAC AAA AAG Asn A AUC AUA AUG lle ACC ACA AGU AGC AGA AGG Thr Lys Arg Met ACG GUU G GUC GUA GUG GCU GAU GAC GAA Asp GGU Val GCC Ala GGC Gly GCA GGA Glu GCG GAG GGG GThe DNA in the coding strand below contains a short imaginary sequence for a short protein in Squibillus notables (imaginary bacterial organism). Indicate the mRNA and amino acid sequences. Label the 5' and 3' ends, the amino (N-terminus) and carboxyl (C-terminus) ends and start/stop codons, if present, as appropriate. 5'- ATGTACCTCGACGATCAAGGCAA -3'Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′